EMAIL THIS PAGE TO A FRIEND

ADCYAP1R1

adenylate cyclase activating polypeptide 1 (pituitary) receptor type I

Synonyms: PAC1 PAC1R PACAPR PACAPRI
UniProtKB ID: P41586, A8K1Y1, B7ZLA7, B8ZZK3, Q17S10
Gene ID:
Human(117) Summary: This gene encodes type I adenylate cyclase activating polypeptide receptor, which is a membrane-associated protein and shares significant homology with members of the glucagon/secretin receptor family. This receptor mediates diverse biological actions of adenylate cyclase activating polypeptide 1 and is positively coupled to adenylate cyclase. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2010]
Mouse(11517) adenylate cyclase activating polypeptide 1 receptor 1
Rat(24167) adenylate cyclase activating polypeptide 1 receptor 1
Zebrafish(555473) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
chicken(420386) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
domestic cat(101088396) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
cow(319095) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
Horse(100069948) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
dog(482386) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
Domestic Rabbit(100009032) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
domestic guinea pig(100716157) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
naked mole-rat(101713524) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078441 MISSION® esiRNA esiRNA targeting mouse Adcyap1r1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001118 Rosetta Predictions human pricing
NM_133511 Rosetta Predictions rat pricing
NM_001025372 Rosetta Predictions mouse pricing
NM_007407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090187 predicted 1399
2 SASI_Hs01_00090188 predicted 278
3 SASI_Hs01_00090189 predicted 1305
4 SASI_Hs01_00090190 predicted 1294
5 SASI_Hs01_00090191 predicted 335
6 SASI_Hs01_00090192 predicted 1166
7 SASI_Hs01_00090193 predicted 937
8 SASI_Hs01_00090194 predicted 1190
9 SASI_Hs02_00326999 predicted 660
10 SASI_Hs01_00090195 predicted 1107
11 SASI_Hs01_00090196 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030863 predicted 1270
2 SASI_Rn01_00030864 predicted 1053
3 SASI_Rn01_00030865 predicted 1040
4 SASI_Rn01_00030866 predicted 1422
5 SASI_Rn01_00030867 predicted 832
6 SASI_Rn01_00030869 predicted 379
7 SASI_Rn01_00030870 predicted 714
8 SASI_Rn01_00030871 predicted 796
9 SASI_Rn01_00030872 predicted 1276
10 SASI_Rn02_00267690 predicted 1589
11 SASI_Rn01_00030868 predicted 1685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193360 predicted 1205
2 SASI_Mm01_00193361 predicted 1179
3 SASI_Mm01_00193362 predicted 1032
4 SASI_Mm01_00193363 predicted 2062
5 SASI_Mm01_00193364 predicted 1185
6 SASI_Mm01_00193365 predicted 2002
7 SASI_Mm01_00193366 predicted 1059
8 SASI_Mm01_00193367 predicted 515
9 SASI_Mm01_00193368 predicted 1056
10 SASI_Mm01_00193369 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133841 predicted 1208
2 SASI_Mm01_00133842 predicted 1181
3 SASI_Mm01_00133843 predicted 1025
4 SASI_Mm01_00133844 predicted 2141
5 SASI_Mm01_00133845 predicted 1181
6 SASI_Mm01_00133846 predicted 2082
7 SASI_Mm01_00133847 predicted 1056
8 SASI_Mm01_00133848 predicted 517
9 SASI_Mm01_00133849 predicted 1055
10 SASI_Mm01_00133850 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001118
ADCYAP1R1 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-822s21c1
Sequence:CCGGCGATCTCCGTCTTCATCAAAGCTCGAGCTTTGATGAAGACGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-1077s21c1
Sequence:CCGGCTACGCTGAGACTCTACTTTGCTCGAGCAAAGTAGAGTCTCAGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-1163s21c1
Sequence:CCGGGTTGGCTCTATCATGGTTAACCTCGAGGTTAACCATGATAGAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-592s21c1
Sequence:CCGGGTCGGAACCCTTCCCTCATTACTCGAGTAATGAGGGAAGGGTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-829s1c1
Sequence:CCGGCGTCTTCATCAAAGACTGGATCTCGAGATCCAGTCTTTGATGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-286s1c1
Sequence:CCGGGCATTCTGACTGCATCTTCAACTCGAGTTGAAGATGCAGTCAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-1309s1c1
Sequence:CCGGCGGAATCCACTACACAGTATTCTCGAGAATACTGTGTAGTGGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-1300s1c1
Sequence:CCGGCCCACTATTCGGAATCCACTACTCGAGTAGTGGATTCCGAATAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-1076s1c1
Sequence:CCGGGCTACGCTGAGACTCTACTTTCTCGAGAAAGTAGAGTCTCAGCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001118
ADCYAP1R1 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-822s21c1
Sequence:CCGGCGATCTCCGTCTTCATCAAAGCTCGAGCTTTGATGAAGACGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-1077s21c1
Sequence:CCGGCTACGCTGAGACTCTACTTTGCTCGAGCAAAGTAGAGTCTCAGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-1163s21c1
Sequence:CCGGGTTGGCTCTATCATGGTTAACCTCGAGGTTAACCATGATAGAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-592s21c1
Sequence:CCGGGTCGGAACCCTTCCCTCATTACTCGAGTAATGAGGGAAGGGTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-829s1c1
Sequence:CCGGCGTCTTCATCAAAGACTGGATCTCGAGATCCAGTCTTTGATGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-286s1c1
Sequence:CCGGGCATTCTGACTGCATCTTCAACTCGAGTTGAAGATGCAGTCAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-1309s1c1
Sequence:CCGGCGGAATCCACTACACAGTATTCTCGAGAATACTGTGTAGTGGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-1300s1c1
Sequence:CCGGCCCACTATTCGGAATCCACTACTCGAGTAGTGGATTCCGAATAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-1076s1c1
Sequence:CCGGGCTACGCTGAGACTCTACTTTCTCGAGAAAGTAGAGTCTCAGCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001118
ADCYAP1R1 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-822s21c1
Sequence:CCGGCGATCTCCGTCTTCATCAAAGCTCGAGCTTTGATGAAGACGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-1077s21c1
Sequence:CCGGCTACGCTGAGACTCTACTTTGCTCGAGCAAAGTAGAGTCTCAGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-1163s21c1
Sequence:CCGGGTTGGCTCTATCATGGTTAACCTCGAGGTTAACCATGATAGAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001118.3-592s21c1
Sequence:CCGGGTCGGAACCCTTCCCTCATTACTCGAGTAATGAGGGAAGGGTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-829s1c1
Sequence:CCGGCGTCTTCATCAAAGACTGGATCTCGAGATCCAGTCTTTGATGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-286s1c1
Sequence:CCGGGCATTCTGACTGCATCTTCAACTCGAGTTGAAGATGCAGTCAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-1309s1c1
Sequence:CCGGCGGAATCCACTACACAGTATTCTCGAGAATACTGTGTAGTGGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-1300s1c1
Sequence:CCGGCCCACTATTCGGAATCCACTACTCGAGTAGTGGATTCCGAATAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001118.3-1076s1c1
Sequence:CCGGGCTACGCTGAGACTCTACTTTCTCGAGAAAGTAGAGTCTCAGCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007407
ADCYAP1R1 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1809s1c1
Sequence:CCGGCCGTTACTTCACTATGGACTTCTCGAGAAGTCCATAGTGAAGTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1394s1c1
Sequence:CCGGGCCCTGTAGTTGGCTCTATAACTCGAGTTATAGAGCCAACTACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1014s1c1
Sequence:CCGGCCGTAACTTCATCCACATGAACTCGAGTTCATGTGGATGAAGTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-657s1c1
Sequence:CCGGGCCTGCTCAAATAGGTGAGATCTCGAGATCTCACCTATTTGAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1515s1c1
Sequence:CCGGCGTGCAGAAATGCTACTGCAACTCGAGTTGCAGTAGCATTTCTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007407
ADCYAP1R1 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1809s1c1
Sequence:CCGGCCGTTACTTCACTATGGACTTCTCGAGAAGTCCATAGTGAAGTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1394s1c1
Sequence:CCGGGCCCTGTAGTTGGCTCTATAACTCGAGTTATAGAGCCAACTACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1014s1c1
Sequence:CCGGCCGTAACTTCATCCACATGAACTCGAGTTCATGTGGATGAAGTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-657s1c1
Sequence:CCGGGCCTGCTCAAATAGGTGAGATCTCGAGATCTCACCTATTTGAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1515s1c1
Sequence:CCGGCGTGCAGAAATGCTACTGCAACTCGAGTTGCAGTAGCATTTCTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007407
ADCYAP1R1 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1809s1c1
Sequence:CCGGCCGTTACTTCACTATGGACTTCTCGAGAAGTCCATAGTGAAGTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1394s1c1
Sequence:CCGGGCCCTGTAGTTGGCTCTATAACTCGAGTTATAGAGCCAACTACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1014s1c1
Sequence:CCGGCCGTAACTTCATCCACATGAACTCGAGTTCATGTGGATGAAGTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-657s1c1
Sequence:CCGGGCCTGCTCAAATAGGTGAGATCTCGAGATCTCACCTATTTGAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007407.2-1515s1c1
Sequence:CCGGCGTGCAGAAATGCTACTGCAACTCGAGTTGCAGTAGCATTTCTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks