EMAIL THIS PAGE TO A FRIEND

ADD1

adducin 1 (alpha)

201 Gene Product Result for
Synonyms: ADDA
Gene ID:
Human(118) Summary: Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
Mouse(11518) adducin 1 (alpha)
Rat(24170) adducin 1 (alpha)
Zebrafish(555511) adducin 1 (alpha)
cow(507193) adducin 1 (alpha)
Horse(100051451) adducin 1 (alpha)
domestic cat(101097481) adducin 1 (alpha)
dog(488796) adducin 1 (alpha)
chicken(422882) adducin 1 (alpha)
naked mole-rat(101699444) adducin 1 (alpha)
domestic guinea pig(100713878) adducin 1 (alpha)
sheep(101123212) adducin 1 (alpha)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A7109 Anti-ADD1 (656-670) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A6984 Anti-ADD1 (71-85) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300450 Anti-ADD1 (Ab-726) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702481 Anti-Add1 antibody produced in rabbit affinity isolated antibody zebrafish
pricing
SAB2702496 Anti-Add1 antibody produced in rabbit affinity isolated antibody zebrafish
pricing
HPA035873 Anti-ADD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA035874 Anti-ADD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500280 Anti-ADD1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4500279 Anti-ADD1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300148 Anti-phospho-ADD1 (pSer726) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503753 Anti-phospho-ADD1 (pSer726) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503892 Anti-phospho-ADD1 (pThr445) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
WH0000118M1 Monoclonal Anti-ADD1 antibody produced in mouse clone 2C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001119 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001119 Rosetta Predictions human pricing
NM_014189 Rosetta Predictions human pricing
NM_014190 Rosetta Predictions human pricing
NM_176801 Rosetta Predictions human pricing
NM_016990 Rosetta Predictions rat pricing
NM_001024458 Rosetta Predictions mouse pricing
NM_001102444 Rosetta Predictions mouse pricing
NM_013457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201647 predicted 569
2 SASI_Hs01_00201648 predicted 576
3 SASI_Hs01_00201650 predicted 1125
4 SASI_Hs02_00327050 predicted 1290
5 SASI_Hs01_00201651 predicted 404
6 SASI_Hs01_00201652 predicted 620
7 SASI_Hs01_00201653 predicted 805
8 SASI_Hs01_00201654 predicted 255
9 SASI_Hs01_00201655 predicted 843
10 SASI_Hs01_00201656 predicted 786
11 SASI_Hs01_00201649 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092247 predicted 569
2 SASI_Hs01_00092248 predicted 585
3 SASI_Hs01_00092250 predicted 1130
4 SASI_Hs02_00345220 predicted 1295
5 SASI_Hs01_00092251 predicted 401
6 SASI_Hs01_00092252 predicted 621
7 SASI_Hs01_00092253 predicted 806
8 SASI_Hs01_00092254 predicted 247
9 SASI_Hs01_00092255 predicted 845
10 SASI_Hs01_00092256 predicted 783
11 SASI_Hs01_00092249 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238966 predicted 572
2 SASI_Hs01_00238967 predicted 584
3 SASI_Hs01_00238969 predicted 1128
4 SASI_Hs02_00345221 predicted 1288
5 SASI_Hs01_00238970 predicted 404
6 SASI_Hs01_00238971 predicted 621
7 SASI_Hs01_00238972 predicted 801
8 SASI_Hs01_00238973 predicted 254
9 SASI_Hs01_00238974 predicted 846
10 SASI_Hs01_00238975 predicted 778
11 SASI_Hs01_00238968 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099037 predicted 570
2 SASI_Hs01_00099038 predicted 584
3 SASI_Hs01_00099040 predicted 1127
4 SASI_Hs02_00369216 predicted 1295
5 SASI_Hs01_00099041 predicted 401
6 SASI_Hs01_00099042 predicted 617
7 SASI_Hs01_00099043 predicted 797
8 SASI_Hs01_00099044 predicted 247
9 SASI_Hs01_00099045 predicted 846
10 SASI_Hs01_00099046 predicted 785
11 SASI_Hs01_00099039 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051634 predicted 458
2 SASI_Rn01_00051635 predicted 440
3 SASI_Rn01_00051637 predicted 673
4 SASI_Rn01_00051638 predicted 1573
5 SASI_Rn01_00051639 predicted 2246
6 SASI_Rn01_00051641 predicted 1509
7 SASI_Rn01_00051642 predicted 482
8 SASI_Rn01_00051643 predicted 1077
9 SASI_Rn02_00261127 predicted 541
10 SASI_Rn02_00261128 predicted 952
11 SASI_Rn01_00051636 predicted 1001
12 SASI_Rn01_00051640 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287576 predicted 641
2 SASI_Mm02_00287577 predicted 602
3 SASI_Mm01_00136636 predicted 1236
4 SASI_Mm02_00287578 predicted 596
5 SASI_Mm02_00287579 predicted 1009
6 SASI_Mm02_00287580 predicted 832
7 SASI_Mm02_00287581 predicted 1157
8 SASI_Mm02_00287582 predicted 2428
9 SASI_Mm02_00287583 predicted 1379
10 SASI_Mm02_00287584 predicted 816
11 SASI_Mm01_00136632 predicted 1670
12 SASI_Mm01_00136633 predicted 1594
13 SASI_Mm01_00136634 predicted 1083
14 SASI_Mm01_00136635 predicted 1598
15 SASI_Mm01_00136637 predicted 1083
16 SASI_Mm01_00136638 predicted 1671
17 SASI_Mm01_00136639 predicted 1669
18 SASI_Mm01_00136640 predicted 1101
19 SASI_Mm01_00136641 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302843 predicted 815
2 SASI_Mm02_00302844 predicted 634
3 SASI_Mm02_00302845 predicted 601
4 SASI_Mm02_00302846 predicted 1230
5 SASI_Mm02_00302847 predicted 597
6 SASI_Mm02_00302848 predicted 1014
7 SASI_Mm02_00302849 predicted 824
8 SASI_Mm02_00302850 predicted 314
9 SASI_Mm02_00302851 predicted 1158
10 SASI_Mm02_00302852 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322052 predicted 635
2 SASI_Mm02_00322053 predicted 2049
3 SASI_Mm02_00322054 predicted 606
4 SASI_Mm02_00322055 predicted 1728
5 SASI_Mm01_00079268 predicted 1228
6 SASI_Mm02_00322056 predicted 597
7 SASI_Mm02_00322057 predicted 1014
8 SASI_Mm02_00322058 predicted 1155
9 SASI_Mm02_00322059 predicted 1376
10 SASI_Mm02_00322060 predicted 818
11 SASI_Mm01_00079264 predicted 1736
12 SASI_Mm01_00079265 predicted 1663
13 SASI_Mm01_00079266 predicted 1149
14 SASI_Mm01_00079267 predicted 1672
15 SASI_Mm01_00079269 predicted 1145
16 SASI_Mm01_00079270 predicted 1732
17 SASI_Mm01_00079271 predicted 1738
18 SASI_Mm01_00079272 predicted 1165
19 SASI_Mm01_00079273 predicted 1693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024458
VALIDATED
ADD1 MISSION shRNA Bacterial Glycerol Stock
adducin 1 (alpha)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-3616s1c1
Sequence:CCGGCCCTTCCTTTATCCCACATATCTCGAGATATGTGGGATAAAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-537s1c1
Sequence:CCGGCCAGCTTATCTACAATCATATCTCGAGATATGATTGTAGATAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-210s1c1
Sequence:CCGGGCAGAAGAAGAGGGTGTCTATCTCGAGATAGACACCCTCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-1310s1c1
Sequence:CCGGCCTTTGCTAGTGATGGCGATTCTCGAGAATCGCCATCACTAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-399s1c1
Sequence:CCGGCCTGAACATGAGTCTTGGTATCTCGAGATACCAAGACTCATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024458.3-3741s21c1
Sequence:CCGGCCCTTCCTTTATCCCACATATCTCGAGATATGTGGGATAAAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-706s21c1
Sequence:CCGGCCAGCTTATCTACAATCATATCTCGAGATATGATTGTAGATAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-1479s21c1
Sequence:CCGGCCTTTGCTAGTGATGGCGATTCTCGAGAATCGCCATCACTAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-568s21c1
Sequence:CCGGCCTGAACATGAGTCTTGGTATCTCGAGATACCAAGACTCATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-379s21c1
Sequence:CCGGGCAGAAGAAGAGGGTGTCTATCTCGAGATAGACACCCTCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024458
VALIDATED
ADD1 MISSION shRNA shRNA Plasmid DNA
adducin 1 (alpha)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-3616s1c1
Sequence:CCGGCCCTTCCTTTATCCCACATATCTCGAGATATGTGGGATAAAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-537s1c1
Sequence:CCGGCCAGCTTATCTACAATCATATCTCGAGATATGATTGTAGATAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-210s1c1
Sequence:CCGGGCAGAAGAAGAGGGTGTCTATCTCGAGATAGACACCCTCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-1310s1c1
Sequence:CCGGCCTTTGCTAGTGATGGCGATTCTCGAGAATCGCCATCACTAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-399s1c1
Sequence:CCGGCCTGAACATGAGTCTTGGTATCTCGAGATACCAAGACTCATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024458.3-3741s21c1
Sequence:CCGGCCCTTCCTTTATCCCACATATCTCGAGATATGTGGGATAAAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-706s21c1
Sequence:CCGGCCAGCTTATCTACAATCATATCTCGAGATATGATTGTAGATAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-1479s21c1
Sequence:CCGGCCTTTGCTAGTGATGGCGATTCTCGAGAATCGCCATCACTAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-568s21c1
Sequence:CCGGCCTGAACATGAGTCTTGGTATCTCGAGATACCAAGACTCATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-379s21c1
Sequence:CCGGGCAGAAGAAGAGGGTGTCTATCTCGAGATAGACACCCTCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024458
VALIDATED
ADD1 MISSION shRNA Lentiviral Transduction Particles
adducin 1 (alpha)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-3616s1c1
Sequence:CCGGCCCTTCCTTTATCCCACATATCTCGAGATATGTGGGATAAAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-537s1c1
Sequence:CCGGCCAGCTTATCTACAATCATATCTCGAGATATGATTGTAGATAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-210s1c1
Sequence:CCGGGCAGAAGAAGAGGGTGTCTATCTCGAGATAGACACCCTCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-1310s1c1
Sequence:CCGGCCTTTGCTAGTGATGGCGATTCTCGAGAATCGCCATCACTAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024458.1-399s1c1
Sequence:CCGGCCTGAACATGAGTCTTGGTATCTCGAGATACCAAGACTCATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024458.3-3741s21c1
Sequence:CCGGCCCTTCCTTTATCCCACATATCTCGAGATATGTGGGATAAAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-706s21c1
Sequence:CCGGCCAGCTTATCTACAATCATATCTCGAGATATGATTGTAGATAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-1479s21c1
Sequence:CCGGCCTTTGCTAGTGATGGCGATTCTCGAGAATCGCCATCACTAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-568s21c1
Sequence:CCGGCCTGAACATGAGTCTTGGTATCTCGAGATACCAAGACTCATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024458.3-379s21c1
Sequence:CCGGGCAGAAGAAGAGGGTGTCTATCTCGAGATAGACACCCTCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001119
VALIDATED
ADD1 MISSION shRNA Bacterial Glycerol Stock
adducin 1 (alpha)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-3138s1c1
Sequence:CCGGGCAGGTTTACAATTTAGCTTACTCGAGTAAGCTAAATTGTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-379s1c1
Sequence:CCGGGCCCTGCTTTCTGTGAAGAATCTCGAGATTCTTCACAGAAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-1712s1c1
Sequence:CCGGGCAGAATTTACAGGACATTAACTCGAGTTAATGTCCTGTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-624s1c1
Sequence:CCGGCGGTGTAAATTGGCAGCGTTTCTCGAGAAACGCTGCCAATTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-1310s1c1
Sequence:CCGGGCAGGAATTTGAAGCCCTCATCTCGAGATGAGGGCTTCAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-624s21c1
Sequence:CCGGCGGTGTAAATTGGCAGCGTTTCTCGAGAAACGCTGCCAATTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-1712s21c1
Sequence:CCGGGCAGAATTTACAGGACATTAACTCGAGTTAATGTCCTGTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-379s21c1
Sequence:CCGGGCCCTGCTTTCTGTGAAGAATCTCGAGATTCTTCACAGAAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001119.3-3138s21c1
Sequence:CCGGGCAGGTTTACAATTTAGCTTACTCGAGTAAGCTAAATTGTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-1310s21c1
Sequence:CCGGGCAGGAATTTGAAGCCCTCATCTCGAGATGAGGGCTTCAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001119
VALIDATED
ADD1 MISSION shRNA shRNA Plasmid DNA
adducin 1 (alpha)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-3138s1c1
Sequence:CCGGGCAGGTTTACAATTTAGCTTACTCGAGTAAGCTAAATTGTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-379s1c1
Sequence:CCGGGCCCTGCTTTCTGTGAAGAATCTCGAGATTCTTCACAGAAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-1712s1c1
Sequence:CCGGGCAGAATTTACAGGACATTAACTCGAGTTAATGTCCTGTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-624s1c1
Sequence:CCGGCGGTGTAAATTGGCAGCGTTTCTCGAGAAACGCTGCCAATTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-1310s1c1
Sequence:CCGGGCAGGAATTTGAAGCCCTCATCTCGAGATGAGGGCTTCAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-624s21c1
Sequence:CCGGCGGTGTAAATTGGCAGCGTTTCTCGAGAAACGCTGCCAATTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-1712s21c1
Sequence:CCGGGCAGAATTTACAGGACATTAACTCGAGTTAATGTCCTGTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-379s21c1
Sequence:CCGGGCCCTGCTTTCTGTGAAGAATCTCGAGATTCTTCACAGAAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001119.3-3138s21c1
Sequence:CCGGGCAGGTTTACAATTTAGCTTACTCGAGTAAGCTAAATTGTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-1310s21c1
Sequence:CCGGGCAGGAATTTGAAGCCCTCATCTCGAGATGAGGGCTTCAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001119
VALIDATED
ADD1 MISSION shRNA Lentiviral Transduction Particles
adducin 1 (alpha)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-3138s1c1
Sequence:CCGGGCAGGTTTACAATTTAGCTTACTCGAGTAAGCTAAATTGTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-379s1c1
Sequence:CCGGGCCCTGCTTTCTGTGAAGAATCTCGAGATTCTTCACAGAAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-1712s1c1
Sequence:CCGGGCAGAATTTACAGGACATTAACTCGAGTTAATGTCCTGTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-624s1c1
Sequence:CCGGCGGTGTAAATTGGCAGCGTTTCTCGAGAAACGCTGCCAATTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001119.3-1310s1c1
Sequence:CCGGGCAGGAATTTGAAGCCCTCATCTCGAGATGAGGGCTTCAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-624s21c1
Sequence:CCGGCGGTGTAAATTGGCAGCGTTTCTCGAGAAACGCTGCCAATTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-1712s21c1
Sequence:CCGGGCAGAATTTACAGGACATTAACTCGAGTTAATGTCCTGTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-379s21c1
Sequence:CCGGGCCCTGCTTTCTGTGAAGAATCTCGAGATTCTTCACAGAAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001119.3-3138s21c1
Sequence:CCGGGCAGGTTTACAATTTAGCTTACTCGAGTAAGCTAAATTGTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001119.3-1310s21c1
Sequence:CCGGGCAGGAATTTGAAGCCCTCATCTCGAGATGAGGGCTTCAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks