EMAIL THIS PAGE TO A FRIEND

ADD2

adducin 2 (beta)

Synonyms: ADDB
Gene ID:
Human(119) Summary: Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
Mouse(11519) adducin 2 (beta)
Rat(24171) adducin 2 (beta)
sheep(101106757) adducin 2 (beta)
Domestic Rabbit(100348972) adducin 2 (beta)
naked mole-rat(101722886) adducin 2 (beta)
Zebrafish(570147) adducin 2 (beta)
dog(610670) adducin 2 (beta)
Horse(100050348) adducin 2 (beta)
cow(518896) adducin 2 (beta)
domestic cat(101097803) adducin 2 (beta)
231 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017483 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081141 MISSION® esiRNA esiRNA human ADD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001617 Rosetta Predictions human pricing
NM_017482 Rosetta Predictions human pricing
NM_017483 Rosetta Predictions human pricing
NM_017484 Rosetta Predictions human pricing
NM_017488 Rosetta Predictions human pricing
NM_001109880 Rosetta Predictions rat pricing
NM_012491 Rosetta Predictions rat pricing
NM_013458 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206284 predicted 769
2 SASI_Hs01_00206285 predicted 760
3 SASI_Hs01_00206286 predicted 549
4 SASI_Hs01_00206288 predicted 768
5 SASI_Hs01_00206289 predicted 761
6 SASI_Hs01_00206290 predicted 755
7 SASI_Hs01_00206291 predicted 736
8 SASI_Hs01_00206292 predicted 722
9 SASI_Hs02_00332175 predicted 516
10 SASI_Hs02_00332176 predicted 662
11 SASI_Hs01_00206287 predicted 735
12 SASI_Hs01_00206293 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051877 predicted 769
2 SASI_Hs01_00051878 predicted 757
3 SASI_Hs01_00051879 predicted 546
4 SASI_Hs01_00051881 predicted 770
5 SASI_Hs01_00051882 predicted 758
6 SASI_Hs01_00051883 predicted 761
7 SASI_Hs01_00051884 predicted 728
8 SASI_Hs01_00051885 predicted 722
9 SASI_Hs02_00350089 predicted 512
10 SASI_Hs02_00350090 predicted 656
11 SASI_Hs01_00051880 predicted 738
12 SASI_Hs01_00051886 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232467 predicted 770
2 SASI_Hs01_00232468 predicted 755
3 SASI_Hs01_00232469 predicted 551
4 SASI_Hs01_00232471 predicted 770
5 SASI_Hs01_00232472 predicted 762
6 SASI_Hs01_00232473 predicted 756
7 SASI_Hs01_00232474 predicted 734
8 SASI_Hs01_00232475 predicted 721
9 SASI_Hs02_00350091 predicted 508
10 SASI_Hs02_00350092 predicted 654
11 SASI_Hs01_00232470 predicted 737
12 SASI_Hs01_00232476 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143545 predicted 771
2 SASI_Hs01_00143546 predicted 757
3 SASI_Hs01_00143547 predicted 548
4 SASI_Hs01_00143549 predicted 769
5 SASI_Hs01_00143550 predicted 757
6 SASI_Hs01_00143551 predicted 763
7 SASI_Hs01_00143552 predicted 734
8 SASI_Hs01_00143553 predicted 723
9 SASI_Hs02_00350093 predicted 516
10 SASI_Hs02_00350094 predicted 662
11 SASI_Hs01_00143548 predicted 742
12 SASI_Hs01_00143554 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089209 predicted 769
2 SASI_Hs01_00089210 predicted 753
3 SASI_Hs01_00089211 predicted 548
4 SASI_Hs01_00089213 predicted 768
5 SASI_Hs01_00089214 predicted 762
6 SASI_Hs01_00089215 predicted 759
7 SASI_Hs01_00089216 predicted 731
8 SASI_Hs01_00089217 predicted 718
9 SASI_Hs02_00350095 predicted 510
10 SASI_Hs02_00350096 predicted 658
11 SASI_Hs01_00089212 predicted 743
12 SASI_Hs01_00089218 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250662 predicted 417
2 SASI_Rn02_00250663 predicted 736
3 SASI_Rn02_00250664 predicted 570
4 SASI_Rn02_00250665 predicted 454
5 SASI_Rn02_00250666 predicted 580
6 SASI_Rn02_00250667 predicted 1042
7 SASI_Rn02_00250668 predicted 595
8 SASI_Rn02_00250669 predicted 1083
9 SASI_Rn02_00250670 predicted 1058
10 SASI_Rn02_00250671 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062420 predicted 412
2 SASI_Rn01_00062422 predicted 736
3 SASI_Rn01_00062423 predicted 571
4 SASI_Rn02_00259524 predicted 458
5 SASI_Rn01_00062424 predicted 576
6 SASI_Rn01_00062425 predicted 1042
7 SASI_Rn01_00062426 predicted 598
8 SASI_Rn01_00062427 predicted 1085
9 SASI_Rn01_00062428 predicted 1052
10 SASI_Rn01_00062429 predicted 987
11 SASI_Rn01_00062421 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128678 predicted 1283
2 SASI_Mm01_00128680 predicted 1886
3 SASI_Mm01_00128681 predicted 1611
4 SASI_Mm01_00128682 predicted 976
5 SASI_Mm01_00128684 predicted 1275
6 SASI_Mm01_00128685 predicted 1383
7 SASI_Mm01_00128686 predicted 553
8 SASI_Mm01_00128687 predicted 437
9 SASI_Mm02_00322061 predicted 1882
10 SASI_Mm02_00322062 predicted 1068
11 SASI_Mm01_00128679 predicted 2256
12 SASI_Mm01_00128683 predicted 2263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017483
VALIDATED
ADD2 MISSION shRNA Bacterial Glycerol Stock
adducin 2 (beta)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000220007    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017483.2-2420s1c1
Sequence:CCGGGGGATGGTTTCATCAACATAACTCGAGTTATGTTGATGAAACCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017483.1-520s1c1
Sequence:CCGGCCTTACTTTGACCGCTTCTCACTCGAGTGAGAAGCGGTCAAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017483.1-1386s1c1
Sequence:CCGGCCCTTTAGTCTCTCCTTCCAACTCGAGTTGGAAGGAGAGACTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017483.1-921s1c1
Sequence:CCGGGAGTGACACCTATGTCACGTTCTCGAGAACGTGACATAGGTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017483.1-1171s1c1
Sequence:CCGGGACGAGGATACCAAAGACGATCTCGAGATCGTCTTTGGTATCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017483.1-805s1c1
Sequence:CCGGCCTATCAATGACCTCCACACACTCGAGTGTGTGGAGGTCATTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017483.1-1264s1c1
Sequence:CCGGGAGAGGAAGAAACTAGAACTTCTCGAGAAGTTCTAGTTTCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017483.1-1417s1c1
Sequence:CCGGGAAGGTACTAAGAAGACAGAACTCGAGTTCTGTCTTCTTAGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017483.1-1372s1c1
Sequence:CCGGGCAGAGACAAAGAGCCCTTTACTCGAGTAAAGGGCTCTTTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017483
VALIDATED
ADD2 MISSION shRNA shRNA Plasmid DNA
adducin 2 (beta)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000220007    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017483.2-2420s1c1
Sequence:CCGGGGGATGGTTTCATCAACATAACTCGAGTTATGTTGATGAAACCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017483.1-520s1c1
Sequence:CCGGCCTTACTTTGACCGCTTCTCACTCGAGTGAGAAGCGGTCAAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017483.1-1386s1c1
Sequence:CCGGCCCTTTAGTCTCTCCTTCCAACTCGAGTTGGAAGGAGAGACTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017483.1-921s1c1
Sequence:CCGGGAGTGACACCTATGTCACGTTCTCGAGAACGTGACATAGGTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017483.1-1171s1c1
Sequence:CCGGGACGAGGATACCAAAGACGATCTCGAGATCGTCTTTGGTATCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017483.1-805s1c1
Sequence:CCGGCCTATCAATGACCTCCACACACTCGAGTGTGTGGAGGTCATTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017483.1-1264s1c1
Sequence:CCGGGAGAGGAAGAAACTAGAACTTCTCGAGAAGTTCTAGTTTCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017483.1-1417s1c1
Sequence:CCGGGAAGGTACTAAGAAGACAGAACTCGAGTTCTGTCTTCTTAGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017483.1-1372s1c1
Sequence:CCGGGCAGAGACAAAGAGCCCTTTACTCGAGTAAAGGGCTCTTTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017483
VALIDATED
ADD2 MISSION shRNA Lentiviral Transduction Particles
adducin 2 (beta)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000220007    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017483.2-2420s1c1
Sequence:CCGGGGGATGGTTTCATCAACATAACTCGAGTTATGTTGATGAAACCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017483.1-520s1c1
Sequence:CCGGCCTTACTTTGACCGCTTCTCACTCGAGTGAGAAGCGGTCAAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017483.1-1386s1c1
Sequence:CCGGCCCTTTAGTCTCTCCTTCCAACTCGAGTTGGAAGGAGAGACTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017483.1-921s1c1
Sequence:CCGGGAGTGACACCTATGTCACGTTCTCGAGAACGTGACATAGGTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017483.1-1171s1c1
Sequence:CCGGGACGAGGATACCAAAGACGATCTCGAGATCGTCTTTGGTATCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017483.1-805s1c1
Sequence:CCGGCCTATCAATGACCTCCACACACTCGAGTGTGTGGAGGTCATTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017483.1-1264s1c1
Sequence:CCGGGAGAGGAAGAAACTAGAACTTCTCGAGAAGTTCTAGTTTCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017483.1-1417s1c1
Sequence:CCGGGAAGGTACTAAGAAGACAGAACTCGAGTTCTGTCTTCTTAGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017483.1-1372s1c1
Sequence:CCGGGCAGAGACAAAGAGCCCTTTACTCGAGTAAAGGGCTCTTTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013458
ADD2 MISSION shRNA Bacterial Glycerol Stock
adducin 2 (beta)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013458.2-2857s1c1
Sequence:CCGGCGCCAATAGAAGTTAATCTTTCTCGAGAAAGATTAACTTCTATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-1010s1c1
Sequence:CCGGCCTGCAAGATTCTGGTGCTAACTCGAGTTAGCACCAGAATCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-1384s1c1
Sequence:CCGGGCCTTTGTGTTTGAAGAGGATCTCGAGATCCTCTTCAAACACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-1589s1c1
Sequence:CCGGGCATGCCCATACGGATTGAAACTCGAGTTTCAATCCGTATGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-720s1c1
Sequence:CCGGCCTGATTAAAGTGAACATTCTCTCGAGAGAATGTTCACTTTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013458
ADD2 MISSION shRNA shRNA Plasmid DNA
adducin 2 (beta)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013458.2-2857s1c1
Sequence:CCGGCGCCAATAGAAGTTAATCTTTCTCGAGAAAGATTAACTTCTATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-1010s1c1
Sequence:CCGGCCTGCAAGATTCTGGTGCTAACTCGAGTTAGCACCAGAATCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-1384s1c1
Sequence:CCGGGCCTTTGTGTTTGAAGAGGATCTCGAGATCCTCTTCAAACACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-1589s1c1
Sequence:CCGGGCATGCCCATACGGATTGAAACTCGAGTTTCAATCCGTATGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-720s1c1
Sequence:CCGGCCTGATTAAAGTGAACATTCTCTCGAGAGAATGTTCACTTTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013458
ADD2 MISSION shRNA Lentiviral Transduction Particles
adducin 2 (beta)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013458.2-2857s1c1
Sequence:CCGGCGCCAATAGAAGTTAATCTTTCTCGAGAAAGATTAACTTCTATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-1010s1c1
Sequence:CCGGCCTGCAAGATTCTGGTGCTAACTCGAGTTAGCACCAGAATCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-1384s1c1
Sequence:CCGGGCCTTTGTGTTTGAAGAGGATCTCGAGATCCTCTTCAAACACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-1589s1c1
Sequence:CCGGGCATGCCCATACGGATTGAAACTCGAGTTTCAATCCGTATGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013458.2-720s1c1
Sequence:CCGGCCTGATTAAAGTGAACATTCTCTCGAGAGAATGTTCACTTTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks