EMAIL THIS PAGE TO A FRIEND

ADD3

adducin 3 (gamma)

197 Gene Product Result for
Synonyms: ADDL
UniProtKB ID: Q9UEY8, D3DRA8, O43243, Q5VU09, Q92773, Q9UEY7
Gene ID:
Human(120) Summary: Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
Mouse(27360) adducin 3 (gamma)
Rat(25230) adducin 3 (gamma)
chicken(373892) adducin 3 (gamma)
cow(505225) adducin 3 (gamma)
Horse(100059447) adducin 3 (gamma)
domestic cat(101091902) adducin 3 (gamma)
dog(486881) adducin 3 (gamma)
naked mole-rat(101715401) adducin 3 (gamma)
domestic guinea pig(100735302) adducin 3 (gamma)
sheep(101117808) adducin 3 (gamma)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019903 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001121 Rosetta Predictions human pricing
NM_016824 Rosetta Predictions human pricing
NM_019903 Rosetta Predictions human pricing
NM_031552 Rosetta Predictions rat pricing
NM_013758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197867 predicted 1640
2 SASI_Hs01_00197868 predicted 851
3 SASI_Hs01_00197869 predicted 723
4 SASI_Hs01_00197870 predicted 882
5 SASI_Hs01_00197871 predicted 744
6 SASI_Hs01_00197872 predicted 1434
7 SASI_Hs02_00327052 predicted 1860
8 SASI_Hs01_00197873 predicted 1305
9 SASI_Hs01_00197875 predicted 661
10 SASI_Hs01_00197876 predicted 1782
11 SASI_Hs01_00197874 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200036 predicted 1645
2 SASI_Hs01_00200037 predicted 843
3 SASI_Hs01_00200038 predicted 724
4 SASI_Hs01_00200039 predicted 880
5 SASI_Hs01_00200040 predicted 743
6 SASI_Hs01_00200041 predicted 1439
7 SASI_Hs02_00349884 predicted 1852
8 SASI_Hs01_00200042 predicted 1312
9 SASI_Hs01_00200044 predicted 659
10 SASI_Hs01_00200045 predicted 1784
11 SASI_Hs01_00200043 predicted 1698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181432 predicted 1482
2 SASI_Hs01_00181433 predicted 681
3 SASI_Hs01_00181434 predicted 565
4 SASI_Hs01_00181435 predicted 719
5 SASI_Hs01_00181436 predicted 584
6 SASI_Hs01_00181437 predicted 1275
7 SASI_Hs02_00352941 predicted 1690
8 SASI_Hs01_00181438 predicted 1144
9 SASI_Hs01_00181440 predicted 492
10 SASI_Hs01_00181441 predicted 1617
11 SASI_Hs01_00181439 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039142 predicted 244
2 SASI_Rn01_00039143 predicted 983
3 SASI_Rn01_00039144 predicted 1442
4 SASI_Rn01_00039145 predicted 1727
5 SASI_Rn02_00264740 predicted 585
6 SASI_Rn02_00264741 predicted 1499
7 SASI_Rn01_00039147 predicted 1597
8 SASI_Rn01_00039149 predicted 596
9 SASI_Rn01_00039150 predicted 1607
10 SASI_Rn02_00264742 predicted 1215
11 SASI_Rn01_00039146 predicted 1785
12 SASI_Rn01_00039148 predicted 1650
13 SASI_Rn01_00039151 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156784 predicted 1429
2 SASI_Mm01_00156785 predicted 588
3 SASI_Mm01_00156786 predicted 620
4 SASI_Mm01_00156787 predicted 963
5 SASI_Mm02_00322705 predicted 1033
6 SASI_Mm01_00156789 predicted 485
7 SASI_Mm01_00156790 predicted 1483
8 SASI_Mm01_00156791 predicted 374
9 SASI_Mm01_00156792 predicted 1900
10 SASI_Mm01_00156793 predicted 380
11 SASI_Mm01_00156788 predicted 884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019903
VALIDATED
ADD3 MISSION shRNA Bacterial Glycerol Stock
adducin 3 (gamma)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-2280s1c1
Sequence:CCGGGCACATCTAAATACCACATTTCTCGAGAAATGTGGTATTTAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-1812s1c1
Sequence:CCGGGCCACCTTCTACTATGCAATTCTCGAGAATTGCATAGTAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019903.3-267s1c1
Sequence:CCGGGCCTCACAAAGAGAGATATTTCTCGAGAAATATCTCTCTTTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-465s1c1
Sequence:CCGGCCCAACTGGATTACTAGCATTCTCGAGAATGCTAGTAATCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-813s1c1
Sequence:CCGGCCAGGGAAGTACCAATTTGAACTCGAGTTCAAATTGGTACTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019903.3-465s21c1
Sequence:CCGGCCCAACTGGATTACTAGCATTCTCGAGAATGCTAGTAATCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_019903.3-813s21c1
Sequence:CCGGCCAGGGAAGTACCAATTTGAACTCGAGTTCAAATTGGTACTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_019903.3-2046s21c1
Sequence:CCGGTAAGCGAGTGAGTAGGTTAAGCTCGAGCTTAACCTACTCACTCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_019903.3-1986s21c1
Sequence:CCGGAGTGCCTGTCATGGTAGTAAACTCGAGTTTACTACCATGACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019903.3-2722s21c1
Sequence:CCGGTAGTATACACTGGCACATAATCTCGAGATTATGTGCCAGTGTATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019903
VALIDATED
ADD3 MISSION shRNA shRNA Plasmid DNA
adducin 3 (gamma)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-2280s1c1
Sequence:CCGGGCACATCTAAATACCACATTTCTCGAGAAATGTGGTATTTAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-1812s1c1
Sequence:CCGGGCCACCTTCTACTATGCAATTCTCGAGAATTGCATAGTAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019903.3-267s1c1
Sequence:CCGGGCCTCACAAAGAGAGATATTTCTCGAGAAATATCTCTCTTTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-465s1c1
Sequence:CCGGCCCAACTGGATTACTAGCATTCTCGAGAATGCTAGTAATCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-813s1c1
Sequence:CCGGCCAGGGAAGTACCAATTTGAACTCGAGTTCAAATTGGTACTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019903.3-465s21c1
Sequence:CCGGCCCAACTGGATTACTAGCATTCTCGAGAATGCTAGTAATCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_019903.3-813s21c1
Sequence:CCGGCCAGGGAAGTACCAATTTGAACTCGAGTTCAAATTGGTACTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_019903.3-2046s21c1
Sequence:CCGGTAAGCGAGTGAGTAGGTTAAGCTCGAGCTTAACCTACTCACTCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_019903.3-1986s21c1
Sequence:CCGGAGTGCCTGTCATGGTAGTAAACTCGAGTTTACTACCATGACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019903.3-2722s21c1
Sequence:CCGGTAGTATACACTGGCACATAATCTCGAGATTATGTGCCAGTGTATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019903
VALIDATED
ADD3 MISSION shRNA Lentiviral Transduction Particles
adducin 3 (gamma)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-2280s1c1
Sequence:CCGGGCACATCTAAATACCACATTTCTCGAGAAATGTGGTATTTAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-1812s1c1
Sequence:CCGGGCCACCTTCTACTATGCAATTCTCGAGAATTGCATAGTAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019903.3-267s1c1
Sequence:CCGGGCCTCACAAAGAGAGATATTTCTCGAGAAATATCTCTCTTTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-465s1c1
Sequence:CCGGCCCAACTGGATTACTAGCATTCTCGAGAATGCTAGTAATCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019903.3-813s1c1
Sequence:CCGGCCAGGGAAGTACCAATTTGAACTCGAGTTCAAATTGGTACTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019903.3-465s21c1
Sequence:CCGGCCCAACTGGATTACTAGCATTCTCGAGAATGCTAGTAATCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_019903.3-813s21c1
Sequence:CCGGCCAGGGAAGTACCAATTTGAACTCGAGTTCAAATTGGTACTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_019903.3-2046s21c1
Sequence:CCGGTAAGCGAGTGAGTAGGTTAAGCTCGAGCTTAACCTACTCACTCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_019903.3-1986s21c1
Sequence:CCGGAGTGCCTGTCATGGTAGTAAACTCGAGTTTACTACCATGACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019903.3-2722s21c1
Sequence:CCGGTAGTATACACTGGCACATAATCTCGAGATTATGTGCCAGTGTATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013758
VALIDATED
ADD3 MISSION shRNA Bacterial Glycerol Stock
adducin 3 (gamma)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-497s1c1
Sequence:CCGGTCCTCGTATGTGAAGGGAGAACTCGAGTTCTCCCTTCACATACGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-498s1c1
Sequence:CCGGCCTCGTATGTGAAGGGAGAAACTCGAGTTTCTCCCTTCACATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-1877s1c1
Sequence:CCGGGCTGCATCTGTTTCACAAATTCTCGAGAATTTGTGAAACAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-1640s1c1
Sequence:CCGGCGGGAACAGAATCGCTATGATCTCGAGATCATAGCGATTCTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-3083s1c1
Sequence:CCGGCGAGTCGTATTTGAACCATATCTCGAGATATGGTTCAAATACGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013758.2-3083s21c1
Sequence:CCGGCGAGTCGTATTTGAACCATATCTCGAGATATGGTTCAAATACGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013758.2-1877s21c1
Sequence:CCGGGCTGCATCTGTTTCACAAATTCTCGAGAATTTGTGAAACAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013758.2-498s21c1
Sequence:CCGGCCTCGTATGTGAAGGGAGAAACTCGAGTTTCTCCCTTCACATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013758.2-1640s21c1
Sequence:CCGGCGGGAACAGAATCGCTATGATCTCGAGATCATAGCGATTCTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013758
VALIDATED
ADD3 MISSION shRNA shRNA Plasmid DNA
adducin 3 (gamma)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-497s1c1
Sequence:CCGGTCCTCGTATGTGAAGGGAGAACTCGAGTTCTCCCTTCACATACGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-498s1c1
Sequence:CCGGCCTCGTATGTGAAGGGAGAAACTCGAGTTTCTCCCTTCACATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-1877s1c1
Sequence:CCGGGCTGCATCTGTTTCACAAATTCTCGAGAATTTGTGAAACAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-1640s1c1
Sequence:CCGGCGGGAACAGAATCGCTATGATCTCGAGATCATAGCGATTCTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-3083s1c1
Sequence:CCGGCGAGTCGTATTTGAACCATATCTCGAGATATGGTTCAAATACGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013758.2-3083s21c1
Sequence:CCGGCGAGTCGTATTTGAACCATATCTCGAGATATGGTTCAAATACGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013758.2-1877s21c1
Sequence:CCGGGCTGCATCTGTTTCACAAATTCTCGAGAATTTGTGAAACAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013758.2-498s21c1
Sequence:CCGGCCTCGTATGTGAAGGGAGAAACTCGAGTTTCTCCCTTCACATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013758.2-1640s21c1
Sequence:CCGGCGGGAACAGAATCGCTATGATCTCGAGATCATAGCGATTCTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013758
VALIDATED
ADD3 MISSION shRNA Lentiviral Transduction Particles
adducin 3 (gamma)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-497s1c1
Sequence:CCGGTCCTCGTATGTGAAGGGAGAACTCGAGTTCTCCCTTCACATACGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-498s1c1
Sequence:CCGGCCTCGTATGTGAAGGGAGAAACTCGAGTTTCTCCCTTCACATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-1877s1c1
Sequence:CCGGGCTGCATCTGTTTCACAAATTCTCGAGAATTTGTGAAACAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-1640s1c1
Sequence:CCGGCGGGAACAGAATCGCTATGATCTCGAGATCATAGCGATTCTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013758.2-3083s1c1
Sequence:CCGGCGAGTCGTATTTGAACCATATCTCGAGATATGGTTCAAATACGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013758.2-3083s21c1
Sequence:CCGGCGAGTCGTATTTGAACCATATCTCGAGATATGGTTCAAATACGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013758.2-1877s21c1
Sequence:CCGGGCTGCATCTGTTTCACAAATTCTCGAGAATTTGTGAAACAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013758.2-498s21c1
Sequence:CCGGCCTCGTATGTGAAGGGAGAAACTCGAGTTTCTCCCTTCACATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013758.2-1640s21c1
Sequence:CCGGCGGGAACAGAATCGCTATGATCTCGAGATCATAGCGATTCTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks