EMAIL THIS PAGE TO A FRIEND

ADGB

androglobin

88 Gene Product Result for
Synonyms: C6orf103
UniProtKB ID: Q8N7X0, Q5T402, Q5T904, Q5T905
Gene ID:
Mouse(215772) androglobin
Zebrafish(555435) androglobin
cow(528523) androglobin
dog(484026) androglobin
sheep(101121178) androglobin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024694 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024694 Rosetta Predictions human pricing
XM_929679 Rosetta Predictions human pricing
XM_933862 Rosetta Predictions human pricing
NM_001127353 Rosetta Predictions mouse pricing
NM_172547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357143 predicted 2124
2 SASI_Hs02_00357144 predicted 595
3 SASI_Hs02_00357145 predicted 439
4 SASI_Hs02_00357146 predicted 2363
5 SASI_Hs02_00357147 predicted 452
6 SASI_Hs02_00357148 predicted 3919
7 SASI_Hs02_00357149 predicted 2848
8 SASI_Hs02_00357150 predicted 3125
9 SASI_Hs02_00357151 predicted 1412
10 SASI_Hs02_00357152 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251039 predicted 3851
2 SASI_Hs01_00251040 predicted 4282
3 SASI_Hs01_00251041 predicted 4340
4 SASI_Hs01_00251042 predicted 4610
5 SASI_Hs01_00251043 predicted 6257
6 SASI_Hs01_00251044 predicted 4640
7 SASI_Hs01_00251045 predicted 5142
8 SASI_Hs01_00251046 predicted 4395
9 SASI_Hs01_00251047 predicted 4285
10 SASI_Hs01_00251048 predicted 3881
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294964 predicted 641
2 SASI_Hs01_00294965 predicted 422
3 SASI_Hs01_00294966 predicted 405
4 SASI_Hs01_00294967 predicted 971
5 SASI_Hs01_00294968 predicted 958
6 SASI_Hs01_00294969 predicted 406
7 SASI_Hs01_00294970 predicted 906
8 SASI_Hs01_00294971 predicted 1037
9 SASI_Hs01_00294972 predicted 413
10 SASI_Hs01_00294973 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310307 predicted 1298
2 SASI_Mm02_00310308 predicted 416
3 SASI_Mm02_00310309 predicted 463
4 SASI_Mm02_00310310 predicted 985
5 SASI_Mm02_00310311 predicted 539
6 SASI_Mm02_00310312 predicted 688
7 SASI_Mm02_00310313 predicted 1006
8 SASI_Mm02_00310314 predicted 1303
9 SASI_Mm02_00310315 predicted 490
10 SASI_Mm02_00310316 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036280 predicted 1306
2 SASI_Mm01_00036281 predicted 427
3 SASI_Mm01_00036282 predicted 473
4 SASI_Mm01_00036283 predicted 1150
5 SASI_Mm01_00036284 predicted 988
6 SASI_Mm01_00036285 predicted 539
7 SASI_Mm01_00036286 predicted 700
8 SASI_Mm01_00036287 predicted 1013
9 SASI_Mm01_00036288 predicted 506
10 SASI_Mm01_00036289 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024694
ADGB MISSION shRNA Bacterial Glycerol Stock
androglobin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-1285s21c1
Sequence:CCGGTGGTCGTATATGCGACATTTACTCGAGTAAATGTCGCATATACGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-3371s21c1
Sequence:CCGGTTACTACATACCCAATGATAACTCGAGTTATCATTGGGTATGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024694.3-5110s21c1
Sequence:GTACCGGTGCCTGCTGTTAAGATATTAGCTCGAGCTAATATCTTAACAGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-2698s21c1
Sequence:CCGGTGGAATGGCTGGACGTTAAATCTCGAGATTTAACGTCCAGCCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-2045s21c1
Sequence:CCGGACGAGTGTCCTACTATCTATTCTCGAGAATAGATAGTAGGACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024694
ADGB MISSION shRNA shRNA Plasmid DNA
androglobin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-1285s21c1
Sequence:CCGGTGGTCGTATATGCGACATTTACTCGAGTAAATGTCGCATATACGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-3371s21c1
Sequence:CCGGTTACTACATACCCAATGATAACTCGAGTTATCATTGGGTATGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024694.3-5110s21c1
Sequence:GTACCGGTGCCTGCTGTTAAGATATTAGCTCGAGCTAATATCTTAACAGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-2698s21c1
Sequence:CCGGTGGAATGGCTGGACGTTAAATCTCGAGATTTAACGTCCAGCCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-2045s21c1
Sequence:CCGGACGAGTGTCCTACTATCTATTCTCGAGAATAGATAGTAGGACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024694
ADGB MISSION shRNA Lentiviral Transduction Particles
androglobin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-1285s21c1
Sequence:CCGGTGGTCGTATATGCGACATTTACTCGAGTAAATGTCGCATATACGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-3371s21c1
Sequence:CCGGTTACTACATACCCAATGATAACTCGAGTTATCATTGGGTATGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024694.3-5110s21c1
Sequence:GTACCGGTGCCTGCTGTTAAGATATTAGCTCGAGCTAATATCTTAACAGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-2698s21c1
Sequence:CCGGTGGAATGGCTGGACGTTAAATCTCGAGATTTAACGTCCAGCCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024694.3-2045s21c1
Sequence:CCGGACGAGTGTCCTACTATCTATTCTCGAGAATAGATAGTAGGACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172547
ADGB MISSION shRNA Bacterial Glycerol Stock
androglobin
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172547.1-420s1c1
Sequence:CCGGCCTGGAAACTCATTCGCCATACTCGAGTATGGCGAATGAGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172547.1-542s1c1
Sequence:CCGGCCATTTACGATTCCAACAGAACTCGAGTTCTGTTGGAATCGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172547.1-243s1c1
Sequence:CCGGCCACCTTTACACCACTCTATTCTCGAGAATAGAGTGGTGTAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172547.1-1643s1c1
Sequence:CCGGCATCACACTTTCTGTTTGAAACTCGAGTTTCAAACAGAAAGTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172547
ADGB MISSION shRNA shRNA Plasmid DNA
androglobin
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172547.1-420s1c1
Sequence:CCGGCCTGGAAACTCATTCGCCATACTCGAGTATGGCGAATGAGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172547.1-542s1c1
Sequence:CCGGCCATTTACGATTCCAACAGAACTCGAGTTCTGTTGGAATCGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172547.1-243s1c1
Sequence:CCGGCCACCTTTACACCACTCTATTCTCGAGAATAGAGTGGTGTAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172547.1-1643s1c1
Sequence:CCGGCATCACACTTTCTGTTTGAAACTCGAGTTTCAAACAGAAAGTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172547
ADGB MISSION shRNA Lentiviral Transduction Particles
androglobin
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172547.1-420s1c1
Sequence:CCGGCCTGGAAACTCATTCGCCATACTCGAGTATGGCGAATGAGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172547.1-542s1c1
Sequence:CCGGCCATTTACGATTCCAACAGAACTCGAGTTCTGTTGGAATCGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172547.1-243s1c1
Sequence:CCGGCCACCTTTACACCACTCTATTCTCGAGAATAGAGTGGTGTAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172547.1-1643s1c1
Sequence:CCGGCATCACACTTTCTGTTTGAAACTCGAGTTTCAAACAGAAAGTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks