EMAIL THIS PAGE TO A FRIEND

ADH1A

alcohol dehydrogenase 1A (class I), alpha polypeptide

24 Gene Product Result for
Synonyms: ADH1
UniProtKB ID: P07327, A8K3E3, Q17R68
Gene ID:
Human(124) Summary: This gene encodes a member of the alcohol dehydrogenase family. The encoded protein is the alpha subunit of class I alcohol dehydrogenase, which consists of several homo- and heterodimers of alpha, beta and gamma subunits. Alcohol dehydrogenases catalyze the oxidation of alcohols to aldehydes. This gene is active in the liver in early fetal life but only weakly active in adult liver. This gene is found in a cluster with six additional alcohol dehydrogenase genes, including those encoding the beta and gamma subunits, on the long arm of chromosome 4. Mutations in this gene may contribute to variation in certain personality traits and substance dependence. [provided by RefSeq, Nov 2010]
Domestic Rabbit(100009283) alcohol dehydrogenase 1A (class I), alpha polypeptide
cow(280982) alcohol dehydrogenase 1A (class I), alpha polypeptide
Horse(100294528) alcohol dehydrogenase 1A (class I), alpha polypeptide
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
222569 Fomepizole 99% human pricing
120685 N-Cyclohexylformamide 99% human, mouse pricing

Kits

Product # Description Species Add to Cart
 
MAK053 Alcohol Dehydrogenase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000667 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000667 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236191 predicted 349
2 SASI_Hs01_00236193 predicted 1021
3 SASI_Hs01_00236195 predicted 1016
4 SASI_Hs02_00303028 predicted 349
5 SASI_Hs02_00303029 predicted 349
6 SASI_Hs02_00303030 predicted 1038
7 SASI_Hs01_00236192 predicted 758
8 SASI_Hs01_00236194 predicted 789
9 SASI_Hs01_00236196 predicted 788
10 SASI_Hs01_00236197 predicted 1101
11 SASI_Hs01_00236198 predicted 898
12 SASI_Hs01_00236199 predicted 219
13 SASI_Hs01_00236200 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000667
ADH1A MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase 1A (class I), alpha polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-350s1c1
Sequence:CCGGCGCTATTCCTCAGTGTGGAAACTCGAGTTTCCACACTGAGGAATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-333s1c1
Sequence:CCGGGATAAAGTCATCCCACTCGCTCTCGAGAGCGAGTGGGATGACTTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-569s1c1
Sequence:CCGGTCTAGAGAAAGTCTGTCTCATCTCGAGATGAGACAGACTTTCTCTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-1176s1c1
Sequence:CCGGATCCGTACCATTCTGATGTTTCTCGAGAAACATCAGAATGGTACGGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-183s1c1
Sequence:CCGGCGTATTAAGATGGTGGCTGTACTCGAGTACAGCCACCATCTTAATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000667.2-1008s21c1
Sequence:CCGGCGTACCTGGAAGGGAGCTATTCTCGAGAATAGCTCCCTTCCAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000667.2-741s21c1
Sequence:CCGGGACATCAACAAGGACAAATTTCTCGAGAAATTTGTCCTTGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000667.2-818s21c1
Sequence:CCGGACCCATCCAGGAGGTGCTAAACTCGAGTTTAGCACCTCCTGGATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000667
ADH1A MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase 1A (class I), alpha polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-350s1c1
Sequence:CCGGCGCTATTCCTCAGTGTGGAAACTCGAGTTTCCACACTGAGGAATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-333s1c1
Sequence:CCGGGATAAAGTCATCCCACTCGCTCTCGAGAGCGAGTGGGATGACTTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-569s1c1
Sequence:CCGGTCTAGAGAAAGTCTGTCTCATCTCGAGATGAGACAGACTTTCTCTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-1176s1c1
Sequence:CCGGATCCGTACCATTCTGATGTTTCTCGAGAAACATCAGAATGGTACGGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-183s1c1
Sequence:CCGGCGTATTAAGATGGTGGCTGTACTCGAGTACAGCCACCATCTTAATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000667.2-1008s21c1
Sequence:CCGGCGTACCTGGAAGGGAGCTATTCTCGAGAATAGCTCCCTTCCAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000667.2-741s21c1
Sequence:CCGGGACATCAACAAGGACAAATTTCTCGAGAAATTTGTCCTTGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000667.2-818s21c1
Sequence:CCGGACCCATCCAGGAGGTGCTAAACTCGAGTTTAGCACCTCCTGGATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000667
ADH1A MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase 1A (class I), alpha polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-350s1c1
Sequence:CCGGCGCTATTCCTCAGTGTGGAAACTCGAGTTTCCACACTGAGGAATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-333s1c1
Sequence:CCGGGATAAAGTCATCCCACTCGCTCTCGAGAGCGAGTGGGATGACTTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-569s1c1
Sequence:CCGGTCTAGAGAAAGTCTGTCTCATCTCGAGATGAGACAGACTTTCTCTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-1176s1c1
Sequence:CCGGATCCGTACCATTCTGATGTTTCTCGAGAAACATCAGAATGGTACGGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000667.2-183s1c1
Sequence:CCGGCGTATTAAGATGGTGGCTGTACTCGAGTACAGCCACCATCTTAATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000667.2-1008s21c1
Sequence:CCGGCGTACCTGGAAGGGAGCTATTCTCGAGAATAGCTCCCTTCCAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000667.2-741s21c1
Sequence:CCGGGACATCAACAAGGACAAATTTCTCGAGAAATTTGTCCTTGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000667.2-818s21c1
Sequence:CCGGACCCATCCAGGAGGTGCTAAACTCGAGTTTAGCACCTCCTGGATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks