EMAIL THIS PAGE TO A FRIEND

ADH1B

alcohol dehydrogenase 1B (class I), beta polypeptide

91 Gene Product Result for
Synonyms: ADH2
UniProtKB ID: P00325, Q13711, Q4ZGI9, Q96KI7
Gene ID:
Human(125) Summary: The protein encoded by this gene is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. This encoded protein, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]
cow(280983) alcohol dehydrogenase 1B (class I), beta polypeptide
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047814 Anti-ADH1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1405429 Anti-ADH1B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV41787 Anti-ADH1B antibody produced in rabbit IgG fraction of antiserum rabbit, rat, bovine, rabbit, horse, canine, human, mouse
immunohistochemistry, western blot pricing
SAB2100059 Anti-ADH1B antibody produced in rabbit affinity isolated antibody mouse, rabbit, human, rat, horse, zebrafish, guinea pig
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
222569 Fomepizole 99% human pricing
120685 N-Cyclohexylformamide 99% human, mouse pricing

Kits

Product # Description Species Add to Cart
 
MAK053 Alcohol Dehydrogenase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000668 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000668 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045402 predicted 1048
2 SASI_Hs01_00045408 predicted 1050
3 SASI_Hs02_00303031 predicted 1301
4 SASI_Hs02_00303032 predicted 627
5 SASI_Hs01_00045399 predicted 1035
6 SASI_Hs01_00045400 predicted 1100
7 SASI_Hs01_00045401 predicted 751
8 SASI_Hs01_00045403 predicted 216
9 SASI_Hs01_00045404 predicted 784
10 SASI_Hs01_00045405 predicted 346
11 SASI_Hs01_00045406 predicted 889
12 SASI_Hs01_00045407 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000668
ADH1B MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase 1B (class I), beta polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000668.4-1592s21c1
Sequence:CCGGCATGCTGGGCCATTGTGATTGCTCGAGCAATCACAATGGCCCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000668.4-1533s21c1
Sequence:CCGGATAATCTTTAGTCATCGAATCCTCGAGGATTCGATGACTAAAGATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000668.4-184s21c1
Sequence:CCGGGCTTATGAAGTTCGCATTAAGCTCGAGCTTAATGCGAACTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000668.4-1034s21c1
Sequence:CCGGGGGCTGTTTATGGTGGCTTTACTCGAGTAAAGCCACCATAAACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-1035s1c1
Sequence:CCGGGCTTTAAGAGTAAAGAAGGTACTCGAGTACCTTCTTTACTCTTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-902s1c1
Sequence:CCGGGCTTCCCTGTTATGTTGTCATCTCGAGATGACAACATAACAGGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-158s1c1
Sequence:CCGGGCACCTCCTAAGGCTTATGAACTCGAGTTCATAAGCCTTAGGAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-1041s1c1
Sequence:CCGGAGAGTAAAGAAGGTATCCCAACTCGAGTTGGGATACCTTCTTTACTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-182s1c1
Sequence:CCGGCGCATTAAGATGGTGGCTGTACTCGAGTACAGCCACCATCTTAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000668
ADH1B MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase 1B (class I), beta polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000668.4-1592s21c1
Sequence:CCGGCATGCTGGGCCATTGTGATTGCTCGAGCAATCACAATGGCCCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000668.4-1533s21c1
Sequence:CCGGATAATCTTTAGTCATCGAATCCTCGAGGATTCGATGACTAAAGATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000668.4-184s21c1
Sequence:CCGGGCTTATGAAGTTCGCATTAAGCTCGAGCTTAATGCGAACTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000668.4-1034s21c1
Sequence:CCGGGGGCTGTTTATGGTGGCTTTACTCGAGTAAAGCCACCATAAACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-1035s1c1
Sequence:CCGGGCTTTAAGAGTAAAGAAGGTACTCGAGTACCTTCTTTACTCTTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-902s1c1
Sequence:CCGGGCTTCCCTGTTATGTTGTCATCTCGAGATGACAACATAACAGGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-158s1c1
Sequence:CCGGGCACCTCCTAAGGCTTATGAACTCGAGTTCATAAGCCTTAGGAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-1041s1c1
Sequence:CCGGAGAGTAAAGAAGGTATCCCAACTCGAGTTGGGATACCTTCTTTACTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-182s1c1
Sequence:CCGGCGCATTAAGATGGTGGCTGTACTCGAGTACAGCCACCATCTTAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000668
ADH1B MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase 1B (class I), beta polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000668.4-1592s21c1
Sequence:CCGGCATGCTGGGCCATTGTGATTGCTCGAGCAATCACAATGGCCCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000668.4-1533s21c1
Sequence:CCGGATAATCTTTAGTCATCGAATCCTCGAGGATTCGATGACTAAAGATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000668.4-184s21c1
Sequence:CCGGGCTTATGAAGTTCGCATTAAGCTCGAGCTTAATGCGAACTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000668.4-1034s21c1
Sequence:CCGGGGGCTGTTTATGGTGGCTTTACTCGAGTAAAGCCACCATAAACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-1035s1c1
Sequence:CCGGGCTTTAAGAGTAAAGAAGGTACTCGAGTACCTTCTTTACTCTTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-902s1c1
Sequence:CCGGGCTTCCCTGTTATGTTGTCATCTCGAGATGACAACATAACAGGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-158s1c1
Sequence:CCGGGCACCTCCTAAGGCTTATGAACTCGAGTTCATAAGCCTTAGGAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-1041s1c1
Sequence:CCGGAGAGTAAAGAAGGTATCCCAACTCGAGTTGGGATACCTTCTTTACTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000668.3-182s1c1
Sequence:CCGGCGCATTAAGATGGTGGCTGTACTCGAGTACAGCCACCATCTTAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks