EMAIL THIS PAGE TO A FRIEND

ADH1C

alcohol dehydrogenase 1C (class I), gamma polypeptide

35 Gene Product Result for
Synonyms: ADH3
UniProtKB ID: P00326, Q4PJ18, Q5WRV0, Q6LBW4, Q6NWV0, Q6NZA7
Gene ID:
Human(126) Summary: This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]
chicken(771920) alcohol dehydrogenase 1C (class I), gamma polypeptide
cow(509744) alcohol dehydrogenase 1C (class I), gamma polypeptide
dog(478489) alcohol dehydrogenase 1C (class I), gamma polypeptide
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
222569 Fomepizole 99% human pricing
120685 N-Cyclohexylformamide 99% human, mouse pricing

Kits

Product # Description Species Add to Cart
 
MAK053 Alcohol Dehydrogenase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000669 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000669 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171443 predicted 1068
2 SASI_Hs02_00303033 predicted 1106
3 SASI_Hs02_00303034 predicted 209
4 SASI_Hs02_00303035 predicted 401
5 SASI_Hs02_00303036 predicted 1046
6 SASI_Hs02_00303037 predicted 1109
7 SASI_Hs01_00171444 predicted 738
8 SASI_Hs01_00171445 predicted 763
9 SASI_Hs01_00171446 predicted 1087
10 SASI_Hs01_00171447 predicted 812
11 SASI_Hs01_00171448 predicted 832
12 SASI_Hs01_00171449 predicted 798
13 SASI_Hs01_00171450 predicted 907
14 SASI_Hs01_00171451 predicted 356
15 SASI_Hs01_00171452 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000669
ADH1C MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase 1C (class I), gamma polypeptide
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000669.2-213s1c1
Sequence:CCGGCGTTCAGATGAGCATGTGGTTCTCGAGAACCACATGCTCATCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000669.2-1009s1c1
Sequence:CCGGGCACGTGGAAAGGAGCTATTTCTCGAGAAATAGCTCCTTTCCACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000669.2-1043s1c1
Sequence:CCGGGAGTAAAGAATCTGTCCCGAACTCGAGTTCGGGACAGATTCTTTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000669.3-977s21c1
Sequence:CCGGGATTCCCAGAACCTCTCAATACTCGAGTATTGAGAGGTTCTGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000669.3-1074s21c1
Sequence:CCCGCCAAACTTGTGGCTGACTTTACTCGAGTAAAGTCAGCCACAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000669.3-694s21c1
Sequence:CCGGGGTCGGCCTATCTGTTGTTATCTCGAGATAACAACAGATAGGCCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000669
ADH1C MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase 1C (class I), gamma polypeptide
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000669.2-213s1c1
Sequence:CCGGCGTTCAGATGAGCATGTGGTTCTCGAGAACCACATGCTCATCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000669.2-1009s1c1
Sequence:CCGGGCACGTGGAAAGGAGCTATTTCTCGAGAAATAGCTCCTTTCCACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000669.2-1043s1c1
Sequence:CCGGGAGTAAAGAATCTGTCCCGAACTCGAGTTCGGGACAGATTCTTTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000669.3-977s21c1
Sequence:CCGGGATTCCCAGAACCTCTCAATACTCGAGTATTGAGAGGTTCTGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000669.3-1074s21c1
Sequence:CCCGCCAAACTTGTGGCTGACTTTACTCGAGTAAAGTCAGCCACAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000669.3-694s21c1
Sequence:CCGGGGTCGGCCTATCTGTTGTTATCTCGAGATAACAACAGATAGGCCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000669
ADH1C MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase 1C (class I), gamma polypeptide
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000669.2-213s1c1
Sequence:CCGGCGTTCAGATGAGCATGTGGTTCTCGAGAACCACATGCTCATCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000669.2-1009s1c1
Sequence:CCGGGCACGTGGAAAGGAGCTATTTCTCGAGAAATAGCTCCTTTCCACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000669.2-1043s1c1
Sequence:CCGGGAGTAAAGAATCTGTCCCGAACTCGAGTTCGGGACAGATTCTTTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000669.3-977s21c1
Sequence:CCGGGATTCCCAGAACCTCTCAATACTCGAGTATTGAGAGGTTCTGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000669.3-1074s21c1
Sequence:CCCGCCAAACTTGTGGCTGACTTTACTCGAGTAAAGTCAGCCACAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000669.3-694s21c1
Sequence:CCGGGGTCGGCCTATCTGTTGTTATCTCGAGATAACAACAGATAGGCCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks