EMAIL THIS PAGE TO A FRIEND

ADH5

alcohol dehydrogenase 5 (class III), chi polypeptide

47 Gene Product Result for
Synonyms: ADH-3 ADHX FALDH FDH GSH-FDH GSNOR
UniProtKB ID: P11766, Q6FHR2
Gene ID:
Human(128) Summary: This gene encodes a member of the alcohol dehydrogenase family. Members of this family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. The encoded protein forms a homodimer. It has virtually no activity for ethanol oxidation, but exhibits high activity for oxidation of long-chain primary alcohols and for oxidation of S-hydroxymethyl-glutathione, a spontaneous adduct between formaldehyde and glutathione. This enzyme is an important component of cellular metabolism for the elimination of formaldehyde, a potent irritant and sensitizing agent that causes lacrymation, rhinitis, pharyngitis, and contact dermatitis. The human genome contains several non-transcribed pseudogenes related to this gene. [provided by RefSeq, Oct 2008]
Mouse(11532) alcohol dehydrogenase 5 (class III), chi polypeptide
Rat(100145871) alcohol dehydrogenase 5 (class III), chi polypeptide
Zebrafish(116517) alcohol dehydrogenase 5
cow(505515) alcohol dehydrogenase 5 (class III), chi polypeptide
domestic cat(101101307) alcohol dehydrogenase 5 (class III), chi polypeptide
dog(609781) alcohol dehydrogenase 5 (class III), chi polypeptide
chicken(422705) alcohol dehydrogenase 5 (class III), chi polypeptide
naked mole-rat(101717353) alcohol dehydrogenase 5 (class III), chi polypeptide
domestic guinea pig(100719427) alcohol dehydrogenase 5 (class III), chi polypeptide
sheep(101112223) alcohol dehydrogenase 5 (class III), chi polypeptide
Domestic Rabbit(100009307) alcohol dehydrogenase 5 (class III), chi polypeptide
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK053 Alcohol Dehydrogenase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000671 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000671 Rosetta Predictions human pricing
NM_001126120 Rosetta Predictions rat pricing
NM_007410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303041 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253023 predicted 267
2 SASI_Rn02_00253024 predicted 312
3 SASI_Rn02_00253025 predicted 1036
4 SASI_Rn02_00253026 predicted 585
5 SASI_Rn02_00253027 predicted 1158
6 SASI_Rn02_00253028 predicted 395
7 SASI_Rn02_00253029 predicted 709
8 SASI_Rn02_00253030 predicted 804
9 SASI_Rn02_00253031 predicted 402
10 SASI_Rn02_00253032 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311553 predicted 1208
2 SASI_Mm02_00311554 predicted 1061
3 SASI_Mm01_00027365 predicted 996
4 SASI_Mm01_00027366 predicted 803
5 SASI_Mm01_00027368 predicted 834
6 SASI_Mm01_00027369 predicted 672
7 SASI_Mm01_00027370 predicted 222
8 SASI_Mm01_00027371 predicted 1072
9 SASI_Mm01_00027372 predicted 705
10 SASI_Mm02_00311555 predicted 591
11 SASI_Mm01_00027363 predicted 633
12 SASI_Mm01_00027364 predicted 218
13 SASI_Mm01_00027367 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007410
VALIDATED
ADH5 MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase 5 (class III), chi polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007410.2-1074s1c1
Sequence:CCGGCGACCAAATTAACCAAGCCTTCTCGAGAAGGCTTGGTTAATTTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007410.2-475s1c1
Sequence:CCGGGCTGACATCTCTGTTGCTAAACTCGAGTTTAGCAACAGAGATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007410.2-1045s1c1
Sequence:CCGGGACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007410.2-73s1c1
Sequence:CCGGCCTCTCTCCATAGAGGAGATACTCGAGTATCTCCTCTATGGAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007410.2-747s1c1
Sequence:CCGGCCAAGACTTCAGTAAATCCATCTCGAGATGGATTTACTGAAGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-1279s21c1
Sequence:CCGGACTAGGCAAATTCCACATAAACTCGAGTTTATGTGGAATTTGCCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-1305s21c1
Sequence:CCGGGCTGCTCATTGTGCAACATTTCTCGAGAAATGTTGCACAATGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-475s21c1
Sequence:CCGGGCTGACATCTCTGTTGCTAAACTCGAGTTTAGCAACAGAGATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-747s21c1
Sequence:CCGGCCAAGACTTCAGTAAATCCATCTCGAGATGGATTTACTGAAGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-1045s21c1
Sequence:CCGGGACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007410
VALIDATED
ADH5 MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase 5 (class III), chi polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007410.2-1074s1c1
Sequence:CCGGCGACCAAATTAACCAAGCCTTCTCGAGAAGGCTTGGTTAATTTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007410.2-475s1c1
Sequence:CCGGGCTGACATCTCTGTTGCTAAACTCGAGTTTAGCAACAGAGATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007410.2-1045s1c1
Sequence:CCGGGACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007410.2-73s1c1
Sequence:CCGGCCTCTCTCCATAGAGGAGATACTCGAGTATCTCCTCTATGGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007410.2-747s1c1
Sequence:CCGGCCAAGACTTCAGTAAATCCATCTCGAGATGGATTTACTGAAGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-1279s21c1
Sequence:CCGGACTAGGCAAATTCCACATAAACTCGAGTTTATGTGGAATTTGCCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-1305s21c1
Sequence:CCGGGCTGCTCATTGTGCAACATTTCTCGAGAAATGTTGCACAATGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-475s21c1
Sequence:CCGGGCTGACATCTCTGTTGCTAAACTCGAGTTTAGCAACAGAGATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-747s21c1
Sequence:CCGGCCAAGACTTCAGTAAATCCATCTCGAGATGGATTTACTGAAGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-1045s21c1
Sequence:CCGGGACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007410
VALIDATED
ADH5 MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase 5 (class III), chi polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007410.2-1074s1c1
Sequence:CCGGCGACCAAATTAACCAAGCCTTCTCGAGAAGGCTTGGTTAATTTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007410.2-475s1c1
Sequence:CCGGGCTGACATCTCTGTTGCTAAACTCGAGTTTAGCAACAGAGATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007410.2-1045s1c1
Sequence:CCGGGACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007410.2-73s1c1
Sequence:CCGGCCTCTCTCCATAGAGGAGATACTCGAGTATCTCCTCTATGGAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007410.2-747s1c1
Sequence:CCGGCCAAGACTTCAGTAAATCCATCTCGAGATGGATTTACTGAAGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-1279s21c1
Sequence:CCGGACTAGGCAAATTCCACATAAACTCGAGTTTATGTGGAATTTGCCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-1305s21c1
Sequence:CCGGGCTGCTCATTGTGCAACATTTCTCGAGAAATGTTGCACAATGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-475s21c1
Sequence:CCGGGCTGACATCTCTGTTGCTAAACTCGAGTTTAGCAACAGAGATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-747s21c1
Sequence:CCGGCCAAGACTTCAGTAAATCCATCTCGAGATGGATTTACTGAAGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007410.2-1045s21c1
Sequence:CCGGGACGAATTTGTGACCGGCAATCTCGAGATTGCCGGTCACAAATTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000671
VALIDATED
ADH5 MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase 5 (class III), chi polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000671.2-346s1c1
Sequence:CCGGCCAGTGATCTTGGGACATGAACTCGAGTTCATGTCCCAAGATCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000671.2-919s1c1
Sequence:CCGGGTGCTCATTGAGATGACCGATCTCGAGATCGGTCATCTCAATGAGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000671.2-682s1c1
Sequence:CCGGTGTGGCATTTCAACCGGTTATCTCGAGATAACCGGTTGAAATGCCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000671.2-370s1c1
Sequence:CCGGGCTGGAATTGTGGAAAGTGTTCTCGAGAACACTTTCCACAATTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000671.2-778s1c1
Sequence:CCGGGCAGTTATCATGGGCTGTAAACTCGAGTTTACAGCCCATGATAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000671.3-837s21c1
Sequence:CCGGGTGCTCATTGAGATGACCGATCTCGAGATCGGTCATCTCAATGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000671.3-600s21c1
Sequence:CCGGTGTGGCATTTCAACCGGTTATCTCGAGATAACCGGTTGAAATGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000671.3-264s21c1
Sequence:CCGGCCAGTGATCTTGGGACATGAACTCGAGTTCATGTCCCAAGATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000671
VALIDATED
ADH5 MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase 5 (class III), chi polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000671.2-346s1c1
Sequence:CCGGCCAGTGATCTTGGGACATGAACTCGAGTTCATGTCCCAAGATCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000671.2-919s1c1
Sequence:CCGGGTGCTCATTGAGATGACCGATCTCGAGATCGGTCATCTCAATGAGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000671.2-682s1c1
Sequence:CCGGTGTGGCATTTCAACCGGTTATCTCGAGATAACCGGTTGAAATGCCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000671.2-370s1c1
Sequence:CCGGGCTGGAATTGTGGAAAGTGTTCTCGAGAACACTTTCCACAATTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000671.2-778s1c1
Sequence:CCGGGCAGTTATCATGGGCTGTAAACTCGAGTTTACAGCCCATGATAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000671.3-837s21c1
Sequence:CCGGGTGCTCATTGAGATGACCGATCTCGAGATCGGTCATCTCAATGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000671.3-600s21c1
Sequence:CCGGTGTGGCATTTCAACCGGTTATCTCGAGATAACCGGTTGAAATGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000671.3-264s21c1
Sequence:CCGGCCAGTGATCTTGGGACATGAACTCGAGTTCATGTCCCAAGATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000671
VALIDATED
ADH5 MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase 5 (class III), chi polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000671.2-346s1c1
Sequence:CCGGCCAGTGATCTTGGGACATGAACTCGAGTTCATGTCCCAAGATCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000671.2-919s1c1
Sequence:CCGGGTGCTCATTGAGATGACCGATCTCGAGATCGGTCATCTCAATGAGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000671.2-682s1c1
Sequence:CCGGTGTGGCATTTCAACCGGTTATCTCGAGATAACCGGTTGAAATGCCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000671.2-370s1c1
Sequence:CCGGGCTGGAATTGTGGAAAGTGTTCTCGAGAACACTTTCCACAATTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000671.2-778s1c1
Sequence:CCGGGCAGTTATCATGGGCTGTAAACTCGAGTTTACAGCCCATGATAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000671.3-837s21c1
Sequence:CCGGGTGCTCATTGAGATGACCGATCTCGAGATCGGTCATCTCAATGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000671.3-600s21c1
Sequence:CCGGTGTGGCATTTCAACCGGTTATCTCGAGATAACCGGTTGAAATGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000671.3-264s21c1
Sequence:CCGGCCAGTGATCTTGGGACATGAACTCGAGTTCATGTCCCAAGATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)