EMAIL THIS PAGE TO A FRIEND

ADH6

alcohol dehydrogenase 6 (class V)

86 Gene Product Result for
Synonyms: ADH-5
UniProtKB ID: P28332, B3KS45, Q58F53
Gene ID:
Human(130) Summary: This gene encodes class V alcohol dehydrogenase, which is a member of the alcohol dehydrogenase family. Members of this family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. This gene is expressed in the stomach as well as in the liver, and it contains a glucocorticoid response element upstream of its 5' UTR, which is a steroid hormone receptor binding site. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(310903) alcohol dehydrogenase 6 (class V)
chicken(395979) alcohol dehydrogenase 6 (class V)
cow(523510) alcohol dehydrogenase 6 (class V)
cow(510551) alcohol dehydrogenase 6 (class V)
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK053 Alcohol Dehydrogenase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000672 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080031 MISSION® esiRNA esiRNA human ADH6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000672 Rosetta Predictions human pricing
NM_001102470 Rosetta Predictions human pricing
NM_001012084 Rosetta Predictions rat pricing
XM_575048 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303042 predicted 401
2 SASI_Hs02_00303043 predicted 450
3 SASI_Hs02_00303044 predicted 630
4 SASI_Hs01_00198341 predicted 819
5 SASI_Hs01_00198343 predicted 743
6 SASI_Hs01_00198344 predicted 706
7 SASI_Hs01_00198348 predicted 600
8 SASI_Hs02_00303045 predicted 887
9 SASI_Hs02_00303046 predicted 347
10 SASI_Hs02_00303047 predicted 870
11 SASI_Hs01_00198339 predicted 1102
12 SASI_Hs01_00198340 predicted 369
13 SASI_Hs01_00198342 predicted 592
14 SASI_Hs01_00198345 predicted 1083
15 SASI_Hs01_00198346 predicted 1120
16 SASI_Hs01_00198347 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323203 predicted 400
2 SASI_Hs02_00323204 predicted 451
3 SASI_Hs02_00323205 predicted 631
4 SASI_Hs02_00323206 predicted 823
5 SASI_Hs02_00323207 predicted 749
6 SASI_Hs02_00323208 predicted 708
7 SASI_Hs02_00323209 predicted 598
8 SASI_Hs02_00323210 predicted 880
9 SASI_Hs02_00323211 predicted 353
10 SASI_Hs02_00323212 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073617 predicted 299
2 SASI_Rn01_00073618 predicted 451
3 SASI_Rn01_00073619 predicted 436
4 SASI_Rn01_00073620 predicted 1167
5 SASI_Rn01_00073621 predicted 1040
6 SASI_Rn02_00200214 predicted 987
7 SASI_Rn01_00073623 predicted 1117
8 SASI_Rn01_00073624 predicted 959
9 SASI_Rn01_00073625 predicted 393
10 SASI_Rn01_00073626 predicted 310
11 SASI_Rn01_00073622 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162445 predicted 1227
2 SASI_Rn01_00162446 predicted 1394
3 SASI_Rn01_00162447 predicted 1598
4 SASI_Rn01_00162448 predicted 1271
5 SASI_Rn01_00162449 predicted 1353
6 SASI_Rn01_00162450 predicted 1479
7 SASI_Rn01_00162451 predicted 1232
8 SASI_Rn01_00162452 predicted 1184
9 SASI_Rn01_00162453 predicted 1508
10 SASI_Rn01_00162454 predicted 1320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000672
ADH6 MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase 6 (class V)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-592s21c1
Sequence:CCGGTCTAGAGAAAGTATGCCTAATCTCGAGATTAGGCATACTTTCTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-193s21c1
Sequence:CCGGGGCAAAGGAAGTTCGCATAAACTCGAGTTTATGCGAACTTCCTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-1139s21c1
Sequence:CCGGCATACTCTGAATCTTGATAAACTCGAGTTTATCAAGATTCAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-536s21c1
Sequence:CCGGTGTGAATACACAGTGATAAAGCTCGAGCTTTATCACTGTGTATTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-306s1c1
Sequence:CCGGGCTGGAATCGTTGAGAGTATTCTCGAGAATACTCTCAACGATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-1104s1c1
Sequence:CCGGGCAGAGAAGTTGAATCTAGATCTCGAGATCTAGATTCAACTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-897s1c1
Sequence:CCGGGCCATTGGAAATCTGGACGTTCTCGAGAACGTCCAGATTTCCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-454s1c1
Sequence:CCGGCCCAACTGATGTCTGATGGTACTCGAGTACCATCAGACATCAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-825s1c1
Sequence:CCGGCAGGACTTAAAGAAACCCATTCTCGAGAATGGGTTTCTTTAAGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000672
ADH6 MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase 6 (class V)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-592s21c1
Sequence:CCGGTCTAGAGAAAGTATGCCTAATCTCGAGATTAGGCATACTTTCTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-193s21c1
Sequence:CCGGGGCAAAGGAAGTTCGCATAAACTCGAGTTTATGCGAACTTCCTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-1139s21c1
Sequence:CCGGCATACTCTGAATCTTGATAAACTCGAGTTTATCAAGATTCAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-536s21c1
Sequence:CCGGTGTGAATACACAGTGATAAAGCTCGAGCTTTATCACTGTGTATTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-306s1c1
Sequence:CCGGGCTGGAATCGTTGAGAGTATTCTCGAGAATACTCTCAACGATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-1104s1c1
Sequence:CCGGGCAGAGAAGTTGAATCTAGATCTCGAGATCTAGATTCAACTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-897s1c1
Sequence:CCGGGCCATTGGAAATCTGGACGTTCTCGAGAACGTCCAGATTTCCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-454s1c1
Sequence:CCGGCCCAACTGATGTCTGATGGTACTCGAGTACCATCAGACATCAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-825s1c1
Sequence:CCGGCAGGACTTAAAGAAACCCATTCTCGAGAATGGGTTTCTTTAAGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000672
ADH6 MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase 6 (class V)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-592s21c1
Sequence:CCGGTCTAGAGAAAGTATGCCTAATCTCGAGATTAGGCATACTTTCTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-193s21c1
Sequence:CCGGGGCAAAGGAAGTTCGCATAAACTCGAGTTTATGCGAACTTCCTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-1139s21c1
Sequence:CCGGCATACTCTGAATCTTGATAAACTCGAGTTTATCAAGATTCAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000672.3-536s21c1
Sequence:CCGGTGTGAATACACAGTGATAAAGCTCGAGCTTTATCACTGTGTATTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-306s1c1
Sequence:CCGGGCTGGAATCGTTGAGAGTATTCTCGAGAATACTCTCAACGATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-1104s1c1
Sequence:CCGGGCAGAGAAGTTGAATCTAGATCTCGAGATCTAGATTCAACTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-897s1c1
Sequence:CCGGGCCATTGGAAATCTGGACGTTCTCGAGAACGTCCAGATTTCCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-454s1c1
Sequence:CCGGCCCAACTGATGTCTGATGGTACTCGAGTACCATCAGACATCAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000672.2-825s1c1
Sequence:CCGGCAGGACTTAAAGAAACCCATTCTCGAGAATGGGTTTCTTTAAGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks