EMAIL THIS PAGE TO A FRIEND

ADH7

alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide

79 Gene Product Result for
Synonyms: ADH4
UniProtKB ID: P40394, A2RRB6, A8MVN9, B2R760, B4DWV6, Q13713
Gene ID:
Human(131) Summary: This gene encodes class IV alcohol dehydrogenase 7 mu or sigma subunit, which is a member of the alcohol dehydrogenase family. Members of this family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. The enzyme encoded by this gene is inefficient in ethanol oxidation, but is the most active as a retinol dehydrogenase; thus it may participate in the synthesis of retinoic acid, a hormone important for cellular differentiation. The expression of this gene is much more abundant in stomach than liver, thus differing from the other known gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(11529) alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
Rat(171178) alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
sheep(101111713) alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
cow(534808) alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
120685 N-Cyclohexylformamide 99% human, mouse pricing

Kits

Product # Description Species Add to Cart
 
MAK053 Alcohol Dehydrogenase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000673 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052761 MISSION® esiRNA esiRNA human ADH7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000673 Rosetta Predictions human pricing
NM_134329 Rosetta Predictions rat pricing
NM_009626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303048 predicted 1343
2 SASI_Hs01_00061351 predicted 796
3 SASI_Hs01_00061352 predicted 1164
4 SASI_Hs01_00061354 predicted 778
5 SASI_Hs01_00061355 predicted 747
6 SASI_Hs01_00061356 predicted 293
7 SASI_Hs01_00061357 predicted 692
8 SASI_Hs01_00061358 predicted 1197
9 SASI_Hs01_00061359 predicted 778
10 SASI_Hs02_00303049 predicted 321
11 SASI_Hs01_00061353 predicted 233
12 SASI_Hs01_00061360 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055048 predicted 332
2 SASI_Rn01_00055050 predicted 236
3 SASI_Rn01_00055051 predicted 229
4 SASI_Rn01_00055052 predicted 775
5 SASI_Rn02_00267871 predicted 561
6 SASI_Rn01_00055053 predicted 703
7 SASI_Rn02_00267872 predicted 285
8 SASI_Rn01_00055054 predicted 509
9 SASI_Rn01_00055056 predicted 1037
10 SASI_Rn02_00267873 predicted 200
11 SASI_Rn01_00055049 predicted 1124
12 SASI_Rn01_00055055 predicted 729
13 SASI_Rn01_00055057 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126167 predicted 396
2 SASI_Mm01_00126168 predicted 301
3 SASI_Mm02_00316578 predicted 288
4 SASI_Mm01_00126169 predicted 281
5 SASI_Mm01_00126171 predicted 1186
6 SASI_Mm01_00126173 predicted 478
7 SASI_Mm01_00126174 predicted 775
8 SASI_Mm02_00316579 predicted 956
9 SASI_Mm01_00126175 predicted 924
10 SASI_Mm01_00126176 predicted 1006
11 SASI_Mm01_00126170 predicted 968
12 SASI_Mm01_00126172 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000673
ADH7 MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000673.4-852s21c1
Sequence:CCGGGTTCCACTTGCGTCGTCTTTGCTCGAGCAAAGACGACGCAAGTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000673.4-1581s21c1
Sequence:CCGGGCACCTGGGAATTAGTATAATCTCGAGATTATACTAATTCCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000673.4-1765s21c1
Sequence:CCGGATGCATCTCCTAGAGTAATATCTCGAGATATTACTCTAGGAGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-1169s1c1
Sequence:CCGGGAAGGATTTGAGCTGCTCAATCTCGAGATTGAGCAGCTCAAATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-242s1c1
Sequence:CCGGCGCACAGATGACCATGTGATACTCGAGTATCACATGGTCATCTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-430s1c1
Sequence:CCGGCCTTTGCATTAGGAGCGATATCTCGAGATATCGCTCCTAATGCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-746s1c1
Sequence:CCGGGCATCTAGGATCATTGGGATTCTCGAGAATCCCAATGATCCTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-593s1c1
Sequence:CCGGCCTCCTGAGAAAGTCTGTTTACTCGAGTAAACAGACTTTCTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000673
ADH7 MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000673.4-852s21c1
Sequence:CCGGGTTCCACTTGCGTCGTCTTTGCTCGAGCAAAGACGACGCAAGTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000673.4-1581s21c1
Sequence:CCGGGCACCTGGGAATTAGTATAATCTCGAGATTATACTAATTCCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000673.4-1765s21c1
Sequence:CCGGATGCATCTCCTAGAGTAATATCTCGAGATATTACTCTAGGAGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-1169s1c1
Sequence:CCGGGAAGGATTTGAGCTGCTCAATCTCGAGATTGAGCAGCTCAAATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-242s1c1
Sequence:CCGGCGCACAGATGACCATGTGATACTCGAGTATCACATGGTCATCTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-430s1c1
Sequence:CCGGCCTTTGCATTAGGAGCGATATCTCGAGATATCGCTCCTAATGCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-746s1c1
Sequence:CCGGGCATCTAGGATCATTGGGATTCTCGAGAATCCCAATGATCCTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-593s1c1
Sequence:CCGGCCTCCTGAGAAAGTCTGTTTACTCGAGTAAACAGACTTTCTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000673
ADH7 MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000673.4-852s21c1
Sequence:CCGGGTTCCACTTGCGTCGTCTTTGCTCGAGCAAAGACGACGCAAGTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000673.4-1581s21c1
Sequence:CCGGGCACCTGGGAATTAGTATAATCTCGAGATTATACTAATTCCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000673.4-1765s21c1
Sequence:CCGGATGCATCTCCTAGAGTAATATCTCGAGATATTACTCTAGGAGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-1169s1c1
Sequence:CCGGGAAGGATTTGAGCTGCTCAATCTCGAGATTGAGCAGCTCAAATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-242s1c1
Sequence:CCGGCGCACAGATGACCATGTGATACTCGAGTATCACATGGTCATCTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-430s1c1
Sequence:CCGGCCTTTGCATTAGGAGCGATATCTCGAGATATCGCTCCTAATGCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-746s1c1
Sequence:CCGGGCATCTAGGATCATTGGGATTCTCGAGAATCCCAATGATCCTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000673.2-593s1c1
Sequence:CCGGCCTCCTGAGAAAGTCTGTTTACTCGAGTAAACAGACTTTCTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009626
VALIDATED
ADH7 MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-393s21c1
Sequence:CCGGCCCTCTTTCTACCACAGTGTACTCGAGTACACTGTGGTAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-260s21c1
Sequence:CCGGCGCACAGATGACCATATAATACTCGAGTATTATATGGTCATCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-1147s21c1
Sequence:CCGGCCAGTTGATAACCCACACCTTCTCGAGAAGGTGTGGGTTATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-952s21c1
Sequence:CCGGCCTCTCATCTTGCCATATGAACTCGAGTTCATATGGCAAGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-894s21c1
Sequence:CCGGGCAACACCATACAGTATACTTCTCGAGAAGTATACTGTATGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-406s1c1
Sequence:CCGGCCCTCTTTCTACCACAGTGTACTCGAGTACACTGTGGTAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-273s1c1
Sequence:CCGGCGCACAGATGACCATATAATACTCGAGTATTATATGGTCATCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009626.2-1160s1c1
Sequence:CCGGCCAGTTGATAACCCACACCTTCTCGAGAAGGTGTGGGTTATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-907s1c1
Sequence:CCGGGCAACACCATACAGTATACTTCTCGAGAAGTATACTGTATGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-965s1c1
Sequence:CCGGCCTCTCATCTTGCCATATGAACTCGAGTTCATATGGCAAGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009626
VALIDATED
ADH7 MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-393s21c1
Sequence:CCGGCCCTCTTTCTACCACAGTGTACTCGAGTACACTGTGGTAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-260s21c1
Sequence:CCGGCGCACAGATGACCATATAATACTCGAGTATTATATGGTCATCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-1147s21c1
Sequence:CCGGCCAGTTGATAACCCACACCTTCTCGAGAAGGTGTGGGTTATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-952s21c1
Sequence:CCGGCCTCTCATCTTGCCATATGAACTCGAGTTCATATGGCAAGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-894s21c1
Sequence:CCGGGCAACACCATACAGTATACTTCTCGAGAAGTATACTGTATGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-406s1c1
Sequence:CCGGCCCTCTTTCTACCACAGTGTACTCGAGTACACTGTGGTAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-273s1c1
Sequence:CCGGCGCACAGATGACCATATAATACTCGAGTATTATATGGTCATCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009626.2-1160s1c1
Sequence:CCGGCCAGTTGATAACCCACACCTTCTCGAGAAGGTGTGGGTTATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-907s1c1
Sequence:CCGGGCAACACCATACAGTATACTTCTCGAGAAGTATACTGTATGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-965s1c1
Sequence:CCGGCCTCTCATCTTGCCATATGAACTCGAGTTCATATGGCAAGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009626
VALIDATED
ADH7 MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-393s21c1
Sequence:CCGGCCCTCTTTCTACCACAGTGTACTCGAGTACACTGTGGTAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-260s21c1
Sequence:CCGGCGCACAGATGACCATATAATACTCGAGTATTATATGGTCATCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-1147s21c1
Sequence:CCGGCCAGTTGATAACCCACACCTTCTCGAGAAGGTGTGGGTTATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-952s21c1
Sequence:CCGGCCTCTCATCTTGCCATATGAACTCGAGTTCATATGGCAAGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009626.4-894s21c1
Sequence:CCGGGCAACACCATACAGTATACTTCTCGAGAAGTATACTGTATGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-406s1c1
Sequence:CCGGCCCTCTTTCTACCACAGTGTACTCGAGTACACTGTGGTAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-273s1c1
Sequence:CCGGCGCACAGATGACCATATAATACTCGAGTATTATATGGTCATCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009626.2-1160s1c1
Sequence:CCGGCCAGTTGATAACCCACACCTTCTCGAGAAGGTGTGGGTTATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-907s1c1
Sequence:CCGGGCAACACCATACAGTATACTTCTCGAGAAGTATACTGTATGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009626.2-965s1c1
Sequence:CCGGCCTCTCATCTTGCCATATGAACTCGAGTTCATATGGCAAGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks