EMAIL THIS PAGE TO A FRIEND

ADHFE1

alcohol dehydrogenase, iron containing, 1

57 Gene Product Result for
Synonyms: ADH8 HOT
UniProtKB ID: Q8IWW8, B4DTJ8, Q49A19, Q68CI7, Q6P2B6, Q96MF9
Gene ID:
Human(137872) Summary: The ADHFE1 gene encodes hydroxyacid-oxoacid transhydrogenase (EC 1.1.99.24), which is responsible for the oxidation of 4-hydroxybutyrate in mammalian tissues (Kardon et al., 2006 [PubMed 16616524]
Mouse(76187) alcohol dehydrogenase, iron containing, 1
Rat(362474) alcohol dehydrogenase, iron containing, 1
Zebrafish(404618) alcohol dehydrogenase, iron containing, 1
chicken(426446) alcohol dehydrogenase, iron containing, 1
cow(507711) alcohol dehydrogenase, iron containing, 1
domestic cat(101088980) alcohol dehydrogenase, iron containing, 1
dog(477899) alcohol dehydrogenase, iron containing, 1
sheep(101113943) alcohol dehydrogenase, iron containing, 1
domestic guinea pig(100719015) alcohol dehydrogenase, iron containing, 1
naked mole-rat(101715530) alcohol dehydrogenase, iron containing, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144650 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144650 Rosetta Predictions human pricing
NM_001025423 Rosetta Predictions rat pricing
NM_175236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227099 predicted 1032
2 SASI_Hs01_00227101 predicted 337
3 SASI_Hs02_00364520 predicted 389
4 SASI_Hs01_00227102 predicted 379
5 SASI_Hs01_00227103 predicted 462
6 SASI_Hs02_00364521 predicted 214
7 SASI_Hs01_00227104 predicted 1421
8 SASI_Hs01_00227105 predicted 1261
9 SASI_Hs01_00227106 predicted 1044
10 SASI_Hs01_00227107 predicted 1490
11 SASI_Hs01_00227100 predicted 315
12 SASI_Hs01_00227108 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025423 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203169 predicted 1413
2 SASI_Rn01_00092413 predicted 769
3 SASI_Rn01_00092414 predicted 451
4 SASI_Rn01_00092415 predicted 240
5 SASI_Rn01_00092416 predicted 494
6 SASI_Rn01_00092417 predicted 744
7 SASI_Rn02_00203170 predicted 1036
8 SASI_Rn01_00092418 predicted 845
9 SASI_Rn01_00092419 predicted 413
10 SASI_Rn01_00092420 predicted 369
11 SASI_Rn01_00092421 predicted 249
12 SASI_Rn01_00092422 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156326 predicted 206
2 SASI_Mm01_00156327 predicted 290
3 SASI_Mm01_00156328 predicted 351
4 SASI_Mm01_00156329 predicted 748
5 SASI_Mm01_00156330 predicted 1005
6 SASI_Mm01_00156331 predicted 439
7 SASI_Mm01_00156332 predicted 212
8 SASI_Mm01_00156333 predicted 963
9 SASI_Mm01_00156334 predicted 388
10 SASI_Mm01_00156335 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175236
VALIDATED
ADHFE1 MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase, iron containing, 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175236.2-1494s1c1
Sequence:CCGGCCGTCTTATCTCCACACTTAACTCGAGTTAAGTGTGGAGATAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-1041s1c1
Sequence:CCGGGCCAAGGAATATAATGTGGATCTCGAGATCCACATTATATTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-525s1c1
Sequence:CCGGCCAGTAACTGTGCCTCTTAAACTCGAGTTTAAGAGGCACAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-474s1c1
Sequence:CCGGCCTCACTCTGAGTTCCTTGATCTCGAGATCAAGGAACTCAGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-1272s1c1
Sequence:CCGGGCTCTTGGTTATTCCAAGGATCTCGAGATCCTTGGAATAACCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175236.4-1031s21c1
Sequence:CCGGTGGCATGTCTTACCCAATTTCCTCGAGGAAATTGGGTAAGACATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175236.4-1429s21c1
Sequence:CCGGCCATGAAACTGTACTAATTAACTCGAGTTAATTAGTACAGTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175236.4-322s21c1
Sequence:CCGGTGGATTCCCTATCGAAGAATGCTCGAGCATTCTTCGATAGGGAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175236.4-1561s21c1
Sequence:CCGGGGTTTGAATGTGATGTGATTTCTCGAGAAATCACATCACATTCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175236
VALIDATED
ADHFE1 MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase, iron containing, 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175236.2-1494s1c1
Sequence:CCGGCCGTCTTATCTCCACACTTAACTCGAGTTAAGTGTGGAGATAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-1041s1c1
Sequence:CCGGGCCAAGGAATATAATGTGGATCTCGAGATCCACATTATATTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-525s1c1
Sequence:CCGGCCAGTAACTGTGCCTCTTAAACTCGAGTTTAAGAGGCACAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-474s1c1
Sequence:CCGGCCTCACTCTGAGTTCCTTGATCTCGAGATCAAGGAACTCAGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-1272s1c1
Sequence:CCGGGCTCTTGGTTATTCCAAGGATCTCGAGATCCTTGGAATAACCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175236.4-1031s21c1
Sequence:CCGGTGGCATGTCTTACCCAATTTCCTCGAGGAAATTGGGTAAGACATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175236.4-1429s21c1
Sequence:CCGGCCATGAAACTGTACTAATTAACTCGAGTTAATTAGTACAGTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175236.4-322s21c1
Sequence:CCGGTGGATTCCCTATCGAAGAATGCTCGAGCATTCTTCGATAGGGAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175236.4-1561s21c1
Sequence:CCGGGGTTTGAATGTGATGTGATTTCTCGAGAAATCACATCACATTCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175236
VALIDATED
ADHFE1 MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase, iron containing, 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175236.2-1494s1c1
Sequence:CCGGCCGTCTTATCTCCACACTTAACTCGAGTTAAGTGTGGAGATAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-1041s1c1
Sequence:CCGGGCCAAGGAATATAATGTGGATCTCGAGATCCACATTATATTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-525s1c1
Sequence:CCGGCCAGTAACTGTGCCTCTTAAACTCGAGTTTAAGAGGCACAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-474s1c1
Sequence:CCGGCCTCACTCTGAGTTCCTTGATCTCGAGATCAAGGAACTCAGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175236.2-1272s1c1
Sequence:CCGGGCTCTTGGTTATTCCAAGGATCTCGAGATCCTTGGAATAACCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175236.4-1031s21c1
Sequence:CCGGTGGCATGTCTTACCCAATTTCCTCGAGGAAATTGGGTAAGACATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175236.4-1429s21c1
Sequence:CCGGCCATGAAACTGTACTAATTAACTCGAGTTAATTAGTACAGTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175236.4-322s21c1
Sequence:CCGGTGGATTCCCTATCGAAGAATGCTCGAGCATTCTTCGATAGGGAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175236.4-1561s21c1
Sequence:CCGGGGTTTGAATGTGATGTGATTTCTCGAGAAATCACATCACATTCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144650
ADHFE1 MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase, iron containing, 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-860s1c1
Sequence:CCGGGCTGTCAGAAATCCCGATGATCTCGAGATCATCGGGATTTCTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-1004s1c1
Sequence:CCGGGCAAAGGATTACAATGTGGATCTCGAGATCCACATTGTAATCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-1192s1c1
Sequence:CCGGCCGGAAATTCTTATTCGATCTCTCGAGAGATCGAATAAGAATTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-401s1c1
Sequence:CCGGGACACCTGTAAGGCTGCTAATCTCGAGATTAGCAGCCTTACAGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144650.2-177s21c1
Sequence:CCGGAGATGGCTGTTTCAAATATTACTCGAGTAATATTTGAAACAGCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144650
ADHFE1 MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase, iron containing, 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-860s1c1
Sequence:CCGGGCTGTCAGAAATCCCGATGATCTCGAGATCATCGGGATTTCTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-1004s1c1
Sequence:CCGGGCAAAGGATTACAATGTGGATCTCGAGATCCACATTGTAATCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-1192s1c1
Sequence:CCGGCCGGAAATTCTTATTCGATCTCTCGAGAGATCGAATAAGAATTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-401s1c1
Sequence:CCGGGACACCTGTAAGGCTGCTAATCTCGAGATTAGCAGCCTTACAGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144650.2-177s21c1
Sequence:CCGGAGATGGCTGTTTCAAATATTACTCGAGTAATATTTGAAACAGCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144650
ADHFE1 MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase, iron containing, 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-860s1c1
Sequence:CCGGGCTGTCAGAAATCCCGATGATCTCGAGATCATCGGGATTTCTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-1004s1c1
Sequence:CCGGGCAAAGGATTACAATGTGGATCTCGAGATCCACATTGTAATCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-1192s1c1
Sequence:CCGGCCGGAAATTCTTATTCGATCTCTCGAGAGATCGAATAAGAATTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144650.1-401s1c1
Sequence:CCGGGACACCTGTAAGGCTGCTAATCTCGAGATTAGCAGCCTTACAGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144650.2-177s21c1
Sequence:CCGGAGATGGCTGTTTCAAATATTACTCGAGTAATATTTGAAACAGCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks