EMAIL THIS PAGE TO A FRIEND

ADIG

adipogenin

163 Gene Product Result for
Synonyms: SMAF1
UniProtKB ID: Q0VDE8
Gene ID:
Human(149685) Summary: ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation (Kim et al., 2005 [PubMed 15567149]
Mouse(246747) adipogenin
Rat(100361007) adipogenin
sheep(100127222) adipogenin
dog(100685988) adipogenin
cow(510677) adipogenin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001018082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001018082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001018082 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018082 Rosetta Predictions human pricing
NM_145635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214840 predicted 385
2 SASI_Hs01_00214841 predicted 475
3 SASI_Hs01_00214842 predicted 379
4 SASI_Hs02_00306992 predicted 390
5 SASI_Hs01_00214843 predicted 510
6 SASI_Hs02_00306993 predicted 383
7 SASI_Hs01_00214844 predicted 339
8 SASI_Hs02_00306994 predicted 382
9 SASI_Hs01_00214846 predicted 334
10 SASI_Hs01_00214847 predicted 389
11 SASI_Hs01_00214845 predicted 277
12 SASI_Hs01_00214848 predicted 359
13 SASI_Hs01_00214849 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036331 predicted 224
2 SASI_Mm01_00036332 predicted 256
3 SASI_Mm01_00036333 predicted 378
4 SASI_Mm01_00036334 predicted 400
5 SASI_Mm01_00036335 predicted 222
6 SASI_Mm01_00036337 predicted 332
7 SASI_Mm01_00036338 predicted 348
8 SASI_Mm01_00036339 predicted 236
9 SASI_Mm02_00341226 predicted 358
10 SASI_Mm02_00341227 predicted 382
11 SASI_Mm01_00036330 predicted 271
12 SASI_Mm01_00036336 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018082
ADIG MISSION shRNA Bacterial Glycerol Stock
adipogenin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-162s1c1
Sequence:CCGGCGCTTCTTACTTAGCCAAGATCTCGAGATCTTGGCTAAGTAAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-397s1c1
Sequence:CCGGCACCATATTAGAGTTTGGTTTCTCGAGAAACCAAACTCTAATATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-396s1c1
Sequence:CCGGCCACCATATTAGAGTTTGGTTCTCGAGAACCAAACTCTAATATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-392s1c1
Sequence:CCGGGCCTCCACCATATTAGAGTTTCTCGAGAAACTCTAATATGGTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-518s1c1
Sequence:CCGGCCAACTCATCTCCTCTTCAGACTCGAGTCTGAAGAGGAGATGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-171s1c1
Sequence:CCGGCTTAGCCAAGATTCAGAGGAACTCGAGTTCCTCTGAATCTTGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-149s1c1
Sequence:CCGGGATCATCTGGCTACGCTTCTTCTCGAGAAGAAGCGTAGCCAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-158s1c1
Sequence:CCGGGCTACGCTTCTTACTTAGCCACTCGAGTGGCTAAGTAAGAAGCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-127s1c1
Sequence:CCGGCTGTGGGTTTGCTGTTGTTATCTCGAGATAACAACAGCAAACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-197s1c1
Sequence:CCGGCTCCAGTGTGTGCTTGGATTGCTCGAGCAATCCAAGCACACACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018082
ADIG MISSION shRNA shRNA Plasmid DNA
adipogenin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-162s1c1
Sequence:CCGGCGCTTCTTACTTAGCCAAGATCTCGAGATCTTGGCTAAGTAAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-397s1c1
Sequence:CCGGCACCATATTAGAGTTTGGTTTCTCGAGAAACCAAACTCTAATATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-396s1c1
Sequence:CCGGCCACCATATTAGAGTTTGGTTCTCGAGAACCAAACTCTAATATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-392s1c1
Sequence:CCGGGCCTCCACCATATTAGAGTTTCTCGAGAAACTCTAATATGGTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-518s1c1
Sequence:CCGGCCAACTCATCTCCTCTTCAGACTCGAGTCTGAAGAGGAGATGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-171s1c1
Sequence:CCGGCTTAGCCAAGATTCAGAGGAACTCGAGTTCCTCTGAATCTTGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-149s1c1
Sequence:CCGGGATCATCTGGCTACGCTTCTTCTCGAGAAGAAGCGTAGCCAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-158s1c1
Sequence:CCGGGCTACGCTTCTTACTTAGCCACTCGAGTGGCTAAGTAAGAAGCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-127s1c1
Sequence:CCGGCTGTGGGTTTGCTGTTGTTATCTCGAGATAACAACAGCAAACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-197s1c1
Sequence:CCGGCTCCAGTGTGTGCTTGGATTGCTCGAGCAATCCAAGCACACACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018082
ADIG MISSION shRNA Lentiviral Transduction Particles
adipogenin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-162s1c1
Sequence:CCGGCGCTTCTTACTTAGCCAAGATCTCGAGATCTTGGCTAAGTAAGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-397s1c1
Sequence:CCGGCACCATATTAGAGTTTGGTTTCTCGAGAAACCAAACTCTAATATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-396s1c1
Sequence:CCGGCCACCATATTAGAGTTTGGTTCTCGAGAACCAAACTCTAATATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-392s1c1
Sequence:CCGGGCCTCCACCATATTAGAGTTTCTCGAGAAACTCTAATATGGTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001018082.1-518s1c1
Sequence:CCGGCCAACTCATCTCCTCTTCAGACTCGAGTCTGAAGAGGAGATGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-171s1c1
Sequence:CCGGCTTAGCCAAGATTCAGAGGAACTCGAGTTCCTCTGAATCTTGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-149s1c1
Sequence:CCGGGATCATCTGGCTACGCTTCTTCTCGAGAAGAAGCGTAGCCAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-158s1c1
Sequence:CCGGGCTACGCTTCTTACTTAGCCACTCGAGTGGCTAAGTAAGAAGCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-127s1c1
Sequence:CCGGCTGTGGGTTTGCTGTTGTTATCTCGAGATAACAACAGCAAACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018082.1-197s1c1
Sequence:CCGGCTCCAGTGTGTGCTTGGATTGCTCGAGCAATCCAAGCACACACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145635
ADIG MISSION shRNA Bacterial Glycerol Stock
adipogenin
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145635.1-268s1c1
Sequence:CCGGCAAAGGAAGATGATTCAGATTCTCGAGAATCTGAATCATCTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-276s1c1
Sequence:CCGGGATGATTCAGATTTGTGCTTCCTCGAGGAAGCACAAATCTGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-237s1c1
Sequence:CCGGGTCTGGTTGCATTTCTTACTTCTCGAGAAGTAAGAAATGCAACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-242s1c1
Sequence:CCGGGTTGCATTTCTTACTTAGTCACTCGAGTGACTAAGTAAGAAATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-285s1c1
Sequence:CCGGGATTTGTGCTTCAACTGGGAGCTCGAGCTCCCAGTTGAAGCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-230s1c1
Sequence:CCGGGACGATCGTCTGGTTGCATTTCTCGAGAAATGCAACCAGACGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145635
ADIG MISSION shRNA shRNA Plasmid DNA
adipogenin
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145635.1-268s1c1
Sequence:CCGGCAAAGGAAGATGATTCAGATTCTCGAGAATCTGAATCATCTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-276s1c1
Sequence:CCGGGATGATTCAGATTTGTGCTTCCTCGAGGAAGCACAAATCTGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-237s1c1
Sequence:CCGGGTCTGGTTGCATTTCTTACTTCTCGAGAAGTAAGAAATGCAACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-242s1c1
Sequence:CCGGGTTGCATTTCTTACTTAGTCACTCGAGTGACTAAGTAAGAAATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-285s1c1
Sequence:CCGGGATTTGTGCTTCAACTGGGAGCTCGAGCTCCCAGTTGAAGCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-230s1c1
Sequence:CCGGGACGATCGTCTGGTTGCATTTCTCGAGAAATGCAACCAGACGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145635
ADIG MISSION shRNA Lentiviral Transduction Particles
adipogenin
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145635.1-268s1c1
Sequence:CCGGCAAAGGAAGATGATTCAGATTCTCGAGAATCTGAATCATCTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-276s1c1
Sequence:CCGGGATGATTCAGATTTGTGCTTCCTCGAGGAAGCACAAATCTGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-237s1c1
Sequence:CCGGGTCTGGTTGCATTTCTTACTTCTCGAGAAGTAAGAAATGCAACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-242s1c1
Sequence:CCGGGTTGCATTTCTTACTTAGTCACTCGAGTGACTAAGTAAGAAATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-285s1c1
Sequence:CCGGGATTTGTGCTTCAACTGGGAGCTCGAGCTCCCAGTTGAAGCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145635.1-230s1c1
Sequence:CCGGGACGATCGTCTGGTTGCATTTCTCGAGAAATGCAACCAGACGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks