EMAIL THIS PAGE TO A FRIEND

ADIPOQ

adiponectin, C1Q and collagen domain containing

184 Gene Product Result for
Synonyms: ACDC ACRP30 ADIPQTL1 ADPN APM-1 APM1 GBP28
UniProtKB ID: Q15848, Q58EX9
Gene ID:
Human(9370) Summary: This gene is expressed in adipose tissue exclusively. It encodes a protein with similarity to collagens X and VIII and complement factor C1q. The encoded protein circulates in the plasma and is involved with metabolic and hormonal processes. Mutations in this gene are associated with adiponectin deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Apr 2010]
Mouse(11450) adiponectin, C1Q and collagen domain containing
Rat(246253) adiponectin, C1Q and collagen domain containing
naked mole-rat(101718713) adiponectin, C1Q and collagen domain containing
domestic guinea pig(100735862) adiponectin, C1Q and collagen domain containing
sheep(101111848) adiponectin, C1Q and collagen domain containing
sheep(100294598) adiponectin, C1Q and collagen domain containing
chicken(404536) adiponectin, C1Q and collagen domain containing
cow(282865) adiponectin, C1Q and collagen domain containing
domestic cat(554338) adiponectin, C1Q and collagen domain containing
dog(403625) adiponectin, C1Q and collagen domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32799 Anti-ACDC antibody produced in rabbit IgG fraction of antiserum pig, horse, rabbit, canine, rabbit, human, rat, bovine, mouse
immunohistochemistry, western blot pricing
A0354 Anti-Adipocyte Complement Related Protein of 30 kDa antibody produced in rabbit ~1 mg/mL, affinity isolated antibody rat
western blot pricing
PRS3551 Anti-Adiponectin (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS3553 Anti-Adiponectin (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
A6354 Anti-Adiponectin antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
SAB1411845 ANTI-ADIPOQ antibody produced in mouse clone 4E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411846 ANTI-ADIPOQ antibody produced in mouse clone 3H2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411847 ANTI-ADIPOQ antibody produced in mouse clone 2G12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411848 ANTI-ADIPOQ antibody produced in mouse clone 4F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411849 ANTI-ADIPOQ antibody produced in mouse clone 2H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411850 ANTI-ADIPOQ antibody produced in mouse clone 2A11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411851 ANTI-ADIPOQ antibody produced in mouse clone 4H2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411852 ANTI-ADIPOQ antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411853 ANTI-ADIPOQ antibody produced in mouse clone 4G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411854 ANTI-ADIPOQ antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA051767 Anti-ADIPOQ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4100327 Monoclonal Anti-ADIPOQ antibody produced in mouse clone ADIPOQ-A277, culture supernatant human
western blot pricing

Proteins

Product # Description Species Add to Cart
 
SRP4901 Adiponectin human recombinant, expressed in E. coli, ≥90% (SDS-PAGE) human pricing
SRP6257 ADIPOQ/Adiponectin/ACRP30 human recombinant, expressed in HEK 293 cells, ≥92% (SDS-PAGE) human pricing
SRP3046 gAcrp30/Adipolean human recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC), cell culture tested human pricing
SRP3047 gAcrp30/Adipolean variant human recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC), cell culture tested human pricing
SRP4591 gAcrp30/Adiponectin human recombinant, expressed in E. coli, ≥98% (SDS-PAGE) human pricing
APREST87594 PrEST Antigen ADIPOQ Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST27206 SILuPrEST ADIPO SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
SRP4902 Adiponectin from mouse recombinant, expressed in E. coli, ≥90% (SDS-PAGE) mouse pricing
SRP3297 ADIPONECTIN mouse recombinant, expressed in Hi-5 Insect cells, ≥95% (SDS-PAGE), ≥95% (HPLC) mouse pricing
SRP3199 gAcrp30 from mouse recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC), cell culture tested mouse pricing
SRP4592 gAcrp30/Adiponectin from mouse recombinant, expressed in E. coli, ≥98% (SDS-PAGE) mouse pricing
SRP4903 Adiponectin from rat recombinant, expressed in E. coli, ≥90% (SDS-PAGE) rat pricing
SRP4593 gAcrp30/Adiponectin from rat recombinant, expressed in E. coli, ≥98% (SDS-PAGE) rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004797 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150631 MISSION® esiRNA esiRNA human ADIPOQ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004797 Rosetta Predictions human pricing
NM_144744 Rosetta Predictions rat pricing
NM_009605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095574 predicted 390
2 SASI_Hs01_00095575 predicted 429
3 SASI_Hs01_00095576 predicted 460
4 SASI_Hs01_00095577 predicted 615
5 SASI_Hs01_00095578 predicted 460
6 SASI_Hs01_00095579 predicted 290
7 SASI_Hs01_00095580 predicted 571
8 SASI_Hs01_00095582 predicted 460
9 SASI_Hs01_00095583 predicted 473
10 SASI_Hs02_00338329 predicted 355
11 SASI_Hs01_00095581 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046934 predicted 425
2 SASI_Rn01_00046935 predicted 570
3 SASI_Rn01_00046936 predicted 398
4 SASI_Rn01_00046937 predicted 403
5 SASI_Rn01_00046939 predicted 339
6 SASI_Rn02_00268625 predicted 506
7 SASI_Rn01_00046940 predicted 642
8 SASI_Rn01_00046941 predicted 227
9 SASI_Rn01_00046942 predicted 404
10 SASI_Rn01_00046943 predicted 680
11 SASI_Rn01_00046938 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316532 predicted 902
2 SASI_Mm01_00102556 predicted 496
3 SASI_Mm01_00102557 predicted 518
4 SASI_Mm01_00102558 predicted 599
5 SASI_Mm01_00102559 predicted 908
6 SASI_Mm02_00316533 predicted 785
7 SASI_Mm01_00102560 predicted 449
8 SASI_Mm01_00102561 predicted 808
9 SASI_Mm01_00102562 predicted 434
10 SASI_Mm01_00102564 predicted 531
11 SASI_Mm01_00102555 predicted 817
12 SASI_Mm01_00102563 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004797
ADIPOQ MISSION shRNA Bacterial Glycerol Stock
adiponectin, C1Q and collagen domain containing
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004797.2-1089s21c1
Sequence:CCAGATGCTCATATCAATCCTATAACTCGAGTTATAGGATTGATATGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004797.2-883s21c1
Sequence:CCGGACGGTTAGGAAGTTGATTATTCTCGAGAATAATCAACTTCCTAACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004797.2-909s21c1
Sequence:CCGGGTTGGAGGCCTTTAGATATTACTCGAGTAATATCTAAAGGCCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-566s1c1
Sequence:CCGGCCTACCACATCACAGTCTATACTCGAGTATAGACTGTGATGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004797.2-1371s1c1
Sequence:CCGGCCTCAGAGAAAGTGGTTCTATCTCGAGATAGAACCACTTTCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-407s1c1
Sequence:CCGGCCTATGTATACCGCTCAGCATCTCGAGATGCTGAGCGGTATACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-465s1c1
Sequence:CCGGCATGCCCATTCGCTTTACCAACTCGAGTTGGTAAAGCGAATGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-625s1c1
Sequence:CCGGGCTATGCTCTTCACCTATGATCTCGAGATCATAGGTGAAGAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004797
ADIPOQ MISSION shRNA shRNA Plasmid DNA
adiponectin, C1Q and collagen domain containing
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004797.2-1089s21c1
Sequence:CCAGATGCTCATATCAATCCTATAACTCGAGTTATAGGATTGATATGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004797.2-883s21c1
Sequence:CCGGACGGTTAGGAAGTTGATTATTCTCGAGAATAATCAACTTCCTAACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004797.2-909s21c1
Sequence:CCGGGTTGGAGGCCTTTAGATATTACTCGAGTAATATCTAAAGGCCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-566s1c1
Sequence:CCGGCCTACCACATCACAGTCTATACTCGAGTATAGACTGTGATGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004797.2-1371s1c1
Sequence:CCGGCCTCAGAGAAAGTGGTTCTATCTCGAGATAGAACCACTTTCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-407s1c1
Sequence:CCGGCCTATGTATACCGCTCAGCATCTCGAGATGCTGAGCGGTATACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-465s1c1
Sequence:CCGGCATGCCCATTCGCTTTACCAACTCGAGTTGGTAAAGCGAATGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-625s1c1
Sequence:CCGGGCTATGCTCTTCACCTATGATCTCGAGATCATAGGTGAAGAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004797
ADIPOQ MISSION shRNA Lentiviral Transduction Particles
adiponectin, C1Q and collagen domain containing
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004797.2-1089s21c1
Sequence:CCAGATGCTCATATCAATCCTATAACTCGAGTTATAGGATTGATATGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004797.2-883s21c1
Sequence:CCGGACGGTTAGGAAGTTGATTATTCTCGAGAATAATCAACTTCCTAACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004797.2-909s21c1
Sequence:CCGGGTTGGAGGCCTTTAGATATTACTCGAGTAATATCTAAAGGCCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-566s1c1
Sequence:CCGGCCTACCACATCACAGTCTATACTCGAGTATAGACTGTGATGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004797.2-1371s1c1
Sequence:CCGGCCTCAGAGAAAGTGGTTCTATCTCGAGATAGAACCACTTTCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-407s1c1
Sequence:CCGGCCTATGTATACCGCTCAGCATCTCGAGATGCTGAGCGGTATACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-465s1c1
Sequence:CCGGCATGCCCATTCGCTTTACCAACTCGAGTTGGTAAAGCGAATGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004797.2-625s1c1
Sequence:CCGGGCTATGCTCTTCACCTATGATCTCGAGATCATAGGTGAAGAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009605
ADIPOQ MISSION shRNA Bacterial Glycerol Stock
adiponectin, C1Q and collagen domain containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009605.4-531s1c1
Sequence:CCGGCTACAACCAACAGAATCATTACTCGAGTAATGATTCTGTTGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009605.4-610s1c1
Sequence:CCGGCACATCACGGTGTACATGAAACTCGAGTTTCATGTACACCGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009605.3-573s1c1
Sequence:CCGGGAGCCTCTTCAAGAAGGACAACTCGAGTTGTCCTTCTTGAAGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009605.3-430s1c1
Sequence:CCGGCCCAATGTACCCATTCGCTTTCTCGAGAAAGCGAATGGGTACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009605.3-518s1c1
Sequence:CCGGCGGGACTCTACTACTTCTCTTCTCGAGAAGAGAAGTAGTAGAGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009605.3-95s1c1
Sequence:CCGGCCGAAGATGACGTTACTACAACTCGAGTTGTAGTAACGTCATCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009605.3-990s1c1
Sequence:CCGGCGACTCTTACATGGTAGCAATCTCGAGATTGCTACCATGTAAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009605.3-848s1c1
Sequence:CCGGGCTTAGTTTGAGAGATTGATTCTCGAGAATCAATCTCTCAAACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009605
ADIPOQ MISSION shRNA shRNA Plasmid DNA
adiponectin, C1Q and collagen domain containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009605.4-531s1c1
Sequence:CCGGCTACAACCAACAGAATCATTACTCGAGTAATGATTCTGTTGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009605.4-610s1c1
Sequence:CCGGCACATCACGGTGTACATGAAACTCGAGTTTCATGTACACCGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009605.3-573s1c1
Sequence:CCGGGAGCCTCTTCAAGAAGGACAACTCGAGTTGTCCTTCTTGAAGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009605.3-430s1c1
Sequence:CCGGCCCAATGTACCCATTCGCTTTCTCGAGAAAGCGAATGGGTACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009605.3-518s1c1
Sequence:CCGGCGGGACTCTACTACTTCTCTTCTCGAGAAGAGAAGTAGTAGAGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009605.3-95s1c1
Sequence:CCGGCCGAAGATGACGTTACTACAACTCGAGTTGTAGTAACGTCATCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009605.3-990s1c1
Sequence:CCGGCGACTCTTACATGGTAGCAATCTCGAGATTGCTACCATGTAAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009605.3-848s1c1
Sequence:CCGGGCTTAGTTTGAGAGATTGATTCTCGAGAATCAATCTCTCAAACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009605
ADIPOQ MISSION shRNA Lentiviral Transduction Particles
adiponectin, C1Q and collagen domain containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009605.4-531s1c1
Sequence:CCGGCTACAACCAACAGAATCATTACTCGAGTAATGATTCTGTTGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009605.4-610s1c1
Sequence:CCGGCACATCACGGTGTACATGAAACTCGAGTTTCATGTACACCGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009605.3-573s1c1
Sequence:CCGGGAGCCTCTTCAAGAAGGACAACTCGAGTTGTCCTTCTTGAAGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009605.3-430s1c1
Sequence:CCGGCCCAATGTACCCATTCGCTTTCTCGAGAAAGCGAATGGGTACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009605.3-518s1c1
Sequence:CCGGCGGGACTCTACTACTTCTCTTCTCGAGAAGAGAAGTAGTAGAGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009605.3-95s1c1
Sequence:CCGGCCGAAGATGACGTTACTACAACTCGAGTTGTAGTAACGTCATCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009605.3-990s1c1
Sequence:CCGGCGACTCTTACATGGTAGCAATCTCGAGATTGCTACCATGTAAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009605.3-848s1c1
Sequence:CCGGGCTTAGTTTGAGAGATTGATTCTCGAGAATCAATCTCTCAAACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks