EMAIL THIS PAGE TO A FRIEND

ADIPOR1

adiponectin receptor 1

Synonyms: ACDCR1 CGI45 PAQR1 TESBP1A
UniProtKB ID: Q96A54, B3KMB0, Q53HS7, Q53YY6, Q9Y360
Gene ID:
Human(51094) Summary: This gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. Binding of adiponectin to the encoded protein results in activation of an AMP-activated kinase signaling pathway which affects levels of fatty acid oxidation and insulin sensitivity. A pseudogene of this gene is located on chromosome 14. [provided by RefSeq, Jan 2012]
Mouse(72674) adiponectin receptor 1
Rat(289036) adiponectin receptor 1
chicken(421148) adiponectin receptor 1
domestic cat(100187713) adiponectin receptor 1
cow(407235) adiponectin receptor 1
Horse(100052436) adiponectin receptor 1
dog(479995) adiponectin receptor 1
Goat(100861392) adiponectin receptor 1
Domestic Rabbit(100144332) adiponectin receptor 1
sheep(101103911) adiponectin receptor 1
domestic guinea pig(100728727) adiponectin receptor 1
naked mole-rat(101709580) adiponectin receptor 1
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015999 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127687 Rosetta Predictions human pricing
NM_015999 siRNAs that have been validated in the lab human pricing
NM_207587 Rosetta Predictions rat pricing
NM_028320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330124 predicted 881
2 SASI_Hs02_00330125 predicted 1197
3 SASI_Hs02_00330126 predicted 542
4 SASI_Hs02_00330127 predicted 557
5 SASI_Hs02_00330128 predicted 497
6 SASI_Hs02_00330129 predicted 1048
7 SASI_Hs02_00330130 predicted 1242
8 SASI_Hs02_00330131 predicted 1342
9 SASI_Hs02_00330132 predicted 848
10 SASI_Hs02_00330133 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015999 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161950 validated 621
1 SASI_Hs01_00161951 validated 1208
1 SASI_Hs01_00161949 validated 882
2 SASI_Hs01_00161953 predicted 545
3 SASI_Hs01_00161954 predicted 567
4 SASI_Hs01_00161955 predicted 505
5 SASI_Hs01_00161956 predicted 1055
6 SASI_Hs01_00161957 predicted 1250
7 SASI_Hs01_00161958 predicted 1352
8 SASI_Hs02_00348678 predicted 851
9 SASI_Hs02_00348679 predicted 269
10 SASI_Hs01_00161952 predicted 1294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103150 predicted 788
2 SASI_Rn01_00103151 predicted 1590
3 SASI_Rn01_00103152 predicted 613
4 SASI_Rn01_00103153 predicted 1205
5 SASI_Rn02_00270403 predicted 881
6 SASI_Rn01_00103154 predicted 1499
7 SASI_Rn01_00103155 predicted 1536
8 SASI_Rn01_00103156 predicted 623
9 SASI_Rn01_00103157 predicted 1159
10 SASI_Rn01_00103158 predicted 446
11 SASI_Rn01_00103159 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194849 predicted 835
2 SASI_Mm01_00194850 predicted 1005
3 SASI_Mm01_00194851 predicted 513
4 SASI_Mm02_00333691 predicted 780
5 SASI_Mm01_00194853 predicted 626
6 SASI_Mm01_00194854 predicted 873
7 SASI_Mm01_00194855 predicted 455
8 SASI_Mm01_00194856 predicted 1149
9 SASI_Mm01_00194857 predicted 1099
10 SASI_Mm01_00194858 predicted 538
11 SASI_Mm01_00194852 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028320
VALIDATED
ADIPOR1 MISSION shRNA Bacterial Glycerol Stock
adiponectin receptor 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028320.2-516s1c1
Sequence:CCGGGACAACGACTACCTGCTACATCTCGAGATGTAGCAGGTAGTCGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028320.2-509s1c1
Sequence:CCGGGCTGAAAGACAACGACTACCTCTCGAGAGGTAGTCGTTGTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028320.2-1628s1c1
Sequence:CCGGCTGGGATTCTTCAGAAATTATCTCGAGATAATTTCTGAAGAATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028320.3-1837s21c1
Sequence:CCGGGTACGTCCAGGCTTCAAATAACTCGAGTTATTTGAAGCCTGGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028320.3-844s21c1
Sequence:CCGGGGGATTGCTCTACTGATTATGCTCGAGCATAATCAGTAGAGCAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028320.3-449s21c1
Sequence:CCGGAGATGGAGGAGTTCGTGTATACTCGAGTATACACGAACTCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028320
VALIDATED
ADIPOR1 MISSION shRNA shRNA Plasmid DNA
adiponectin receptor 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028320.2-516s1c1
Sequence:CCGGGACAACGACTACCTGCTACATCTCGAGATGTAGCAGGTAGTCGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028320.2-509s1c1
Sequence:CCGGGCTGAAAGACAACGACTACCTCTCGAGAGGTAGTCGTTGTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028320.2-1628s1c1
Sequence:CCGGCTGGGATTCTTCAGAAATTATCTCGAGATAATTTCTGAAGAATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028320.3-1837s21c1
Sequence:CCGGGTACGTCCAGGCTTCAAATAACTCGAGTTATTTGAAGCCTGGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028320.3-844s21c1
Sequence:CCGGGGGATTGCTCTACTGATTATGCTCGAGCATAATCAGTAGAGCAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028320.3-449s21c1
Sequence:CCGGAGATGGAGGAGTTCGTGTATACTCGAGTATACACGAACTCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028320
VALIDATED
ADIPOR1 MISSION shRNA Lentiviral Transduction Particles
adiponectin receptor 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028320.2-516s1c1
Sequence:CCGGGACAACGACTACCTGCTACATCTCGAGATGTAGCAGGTAGTCGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028320.2-509s1c1
Sequence:CCGGGCTGAAAGACAACGACTACCTCTCGAGAGGTAGTCGTTGTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028320.2-1628s1c1
Sequence:CCGGCTGGGATTCTTCAGAAATTATCTCGAGATAATTTCTGAAGAATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028320.3-1837s21c1
Sequence:CCGGGTACGTCCAGGCTTCAAATAACTCGAGTTATTTGAAGCCTGGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028320.3-844s21c1
Sequence:CCGGGGGATTGCTCTACTGATTATGCTCGAGCATAATCAGTAGAGCAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028320.3-449s21c1
Sequence:CCGGAGATGGAGGAGTTCGTGTATACTCGAGTATACACGAACTCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015999
VALIDATED
ADIPOR1 MISSION shRNA Bacterial Glycerol Stock
adiponectin receptor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015999.2-1033s1c1
Sequence:CCGGGCCCACCATGCACTTTACTATCTCGAGATAGTAAAGTGCATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015999.2-329s1c1
Sequence:CCGGCCCAAAGCTGAAGAAGAGCAACTCGAGTTGCTCTTCTTCAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015999.2-617s1c1
Sequence:CCGGCTGCTTGGTTTCGTGCTGTTTCTCGAGAAACAGCACGAAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015999.2-1243s1c1
Sequence:CCGGCCACTTCTATGGAGTCTCCAACTCGAGTTGGAGACTCCATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015999.2-769s1c1
Sequence:CCGGCGTCTATTGTCATTCAGAGAACTCGAGTTCTCTGAATGACAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-403s21c1
Sequence:CCGGCCCAAAGCTGAAGAAGAGCAACTCGAGTTGCTCTTCTTCAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-1107s21c1
Sequence:CCGGGCCCACCATGCACTTTACTATCTCGAGATAGTAAAGTGCATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-843s21c1
Sequence:CCGGCGTCTATTGTCATTCAGAGAACTCGAGTTCTCTGAATGACAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-691s21c1
Sequence:CCGGCTGCTTGGTTTCGTGCTGTTTCTCGAGAAACAGCACGAAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015999.3-1317s21c1
Sequence:CCGGCCACTTCTATGGAGTCTCCAACTCGAGTTGGAGACTCCATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015999
VALIDATED
ADIPOR1 MISSION shRNA shRNA Plasmid DNA
adiponectin receptor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015999.2-1033s1c1
Sequence:CCGGGCCCACCATGCACTTTACTATCTCGAGATAGTAAAGTGCATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015999.2-329s1c1
Sequence:CCGGCCCAAAGCTGAAGAAGAGCAACTCGAGTTGCTCTTCTTCAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015999.2-617s1c1
Sequence:CCGGCTGCTTGGTTTCGTGCTGTTTCTCGAGAAACAGCACGAAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015999.2-1243s1c1
Sequence:CCGGCCACTTCTATGGAGTCTCCAACTCGAGTTGGAGACTCCATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015999.2-769s1c1
Sequence:CCGGCGTCTATTGTCATTCAGAGAACTCGAGTTCTCTGAATGACAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-403s21c1
Sequence:CCGGCCCAAAGCTGAAGAAGAGCAACTCGAGTTGCTCTTCTTCAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-1107s21c1
Sequence:CCGGGCCCACCATGCACTTTACTATCTCGAGATAGTAAAGTGCATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-843s21c1
Sequence:CCGGCGTCTATTGTCATTCAGAGAACTCGAGTTCTCTGAATGACAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-691s21c1
Sequence:CCGGCTGCTTGGTTTCGTGCTGTTTCTCGAGAAACAGCACGAAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015999.3-1317s21c1
Sequence:CCGGCCACTTCTATGGAGTCTCCAACTCGAGTTGGAGACTCCATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015999
VALIDATED
ADIPOR1 MISSION shRNA Lentiviral Transduction Particles
adiponectin receptor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015999.2-1033s1c1
Sequence:CCGGGCCCACCATGCACTTTACTATCTCGAGATAGTAAAGTGCATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015999.2-329s1c1
Sequence:CCGGCCCAAAGCTGAAGAAGAGCAACTCGAGTTGCTCTTCTTCAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015999.2-617s1c1
Sequence:CCGGCTGCTTGGTTTCGTGCTGTTTCTCGAGAAACAGCACGAAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015999.2-1243s1c1
Sequence:CCGGCCACTTCTATGGAGTCTCCAACTCGAGTTGGAGACTCCATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015999.2-769s1c1
Sequence:CCGGCGTCTATTGTCATTCAGAGAACTCGAGTTCTCTGAATGACAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-403s21c1
Sequence:CCGGCCCAAAGCTGAAGAAGAGCAACTCGAGTTGCTCTTCTTCAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-1107s21c1
Sequence:CCGGGCCCACCATGCACTTTACTATCTCGAGATAGTAAAGTGCATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-843s21c1
Sequence:CCGGCGTCTATTGTCATTCAGAGAACTCGAGTTCTCTGAATGACAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015999.3-691s21c1
Sequence:CCGGCTGCTTGGTTTCGTGCTGTTTCTCGAGAAACAGCACGAAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015999.3-1317s21c1
Sequence:CCGGCCACTTCTATGGAGTCTCCAACTCGAGTTGGAGACTCCATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks