EMAIL THIS PAGE TO A FRIEND

ADIPOR2

adiponectin receptor 2

159 Gene Product Result for
Synonyms: ACDCR2 PAQR2
UniProtKB ID: Q86V24, Q53YY5, Q9H737
Gene ID:
Human(79602) Summary: The adiponectin receptors, ADIPOR1 (MIM 607945) and ADIPOR2, serve as receptors for globular and full-length adiponectin (MIM 605441) and mediate increased AMPK (see MIM 602739) and PPAR-alpha (PPARA; MIM 170998) ligand activities, as well as fatty acid oxidation and glucose uptake by adiponectin (Yamauchi et al., 2003 [PubMed 12802337]
Mouse(68465) adiponectin receptor 2
Rat(312670) adiponectin receptor 2
Zebrafish(560140) adiponectin receptor 2
chicken(418155) adiponectin receptor 2
dog(477732) adiponectin receptor 2
Horse(100050051) adiponectin receptor 2
cow(407234) adiponectin receptor 2
domestic cat(101085553) adiponectin receptor 2
naked mole-rat(101726203) adiponectin receptor 2
domestic guinea pig(100720849) adiponectin receptor 2
sheep(101116044) adiponectin receptor 2
Domestic Rabbit(100144331) adiponectin receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024551 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_197985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024551 siRNAs that have been validated in the lab human pricing
NM_001037979 Rosetta Predictions rat pricing
NM_197985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024551 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023112 validated 338
1 SASI_Hs01_00023113 validated 578
1 SASI_Hs01_00023111 validated 848
2 SASI_Hs01_00023114 predicted 1225
3 SASI_Hs01_00023115 predicted 651
4 SASI_Hs01_00023116 predicted 967
5 SASI_Hs01_00023117 predicted 638
6 SASI_Hs01_00023118 predicted 293
7 SASI_Hs01_00023119 predicted 389
8 SASI_Hs01_00023120 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039407 predicted 783
2 SASI_Rn01_00039408 predicted 661
3 SASI_Rn01_00039409 predicted 454
4 SASI_Rn01_00039410 predicted 346
5 SASI_Rn01_00039411 predicted 342
6 SASI_Rn01_00039412 predicted 255
7 SASI_Rn01_00039414 predicted 446
8 SASI_Rn01_00039415 predicted 286
9 SASI_Rn01_00039416 predicted 441
10 SASI_Rn02_00204657 predicted 711
11 SASI_Rn01_00039413 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058384 predicted 1254
2 SASI_Mm01_00058385 predicted 920
3 SASI_Mm01_00058386 predicted 802
4 SASI_Mm01_00058387 predicted 1154
5 SASI_Mm01_00058389 predicted 601
6 SASI_Mm01_00058390 predicted 840
7 SASI_Mm01_00058391 predicted 715
8 SASI_Mm01_00058392 predicted 586
9 SASI_Mm01_00058393 predicted 397
10 SASI_Mm02_00350669 predicted 198
11 SASI_Mm01_00058388 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024551
VALIDATED
ADIPOR2 MISSION shRNA Bacterial Glycerol Stock
adiponectin receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-930s21c1
Sequence:CCGGCCTTGCTTCATCTACTTGATTCTCGAGAATCAAGTAGATGAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-1054s21c1
Sequence:CCGGGCCTGAGTGGAATCATTCCTACTCGAGTAGGAATGATTCCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-836s21c1
Sequence:CCGGGCTCTTCTCTAAACTGGATTACTCGAGTAATCCAGTTTAGAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-245s21c1
Sequence:CCGGGCCAGATATAAGGCTCAGAAACTCGAGTTTCTGAGCCTTATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-245s1c1
Sequence:CCGGGCCAGATATAAGGCTCAGAAACTCGAGTTTCTGAGCCTTATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-930s1c1
Sequence:CCGGCCTTGCTTCATCTACTTGATTCTCGAGAATCAAGTAGATGAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-836s1c1
Sequence:CCGGGCTCTTCTCTAAACTGGATTACTCGAGTAATCCAGTTTAGAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-1054s1c1
Sequence:CCGGGCCTGAGTGGAATCATTCCTACTCGAGTAGGAATGATTCCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024551
VALIDATED
ADIPOR2 MISSION shRNA shRNA Plasmid DNA
adiponectin receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-930s21c1
Sequence:CCGGCCTTGCTTCATCTACTTGATTCTCGAGAATCAAGTAGATGAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-1054s21c1
Sequence:CCGGGCCTGAGTGGAATCATTCCTACTCGAGTAGGAATGATTCCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-836s21c1
Sequence:CCGGGCTCTTCTCTAAACTGGATTACTCGAGTAATCCAGTTTAGAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-245s21c1
Sequence:CCGGGCCAGATATAAGGCTCAGAAACTCGAGTTTCTGAGCCTTATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-245s1c1
Sequence:CCGGGCCAGATATAAGGCTCAGAAACTCGAGTTTCTGAGCCTTATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-930s1c1
Sequence:CCGGCCTTGCTTCATCTACTTGATTCTCGAGAATCAAGTAGATGAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-836s1c1
Sequence:CCGGGCTCTTCTCTAAACTGGATTACTCGAGTAATCCAGTTTAGAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-1054s1c1
Sequence:CCGGGCCTGAGTGGAATCATTCCTACTCGAGTAGGAATGATTCCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024551
VALIDATED
ADIPOR2 MISSION shRNA Lentiviral Transduction Particles
adiponectin receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-930s21c1
Sequence:CCGGCCTTGCTTCATCTACTTGATTCTCGAGAATCAAGTAGATGAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-1054s21c1
Sequence:CCGGGCCTGAGTGGAATCATTCCTACTCGAGTAGGAATGATTCCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-836s21c1
Sequence:CCGGGCTCTTCTCTAAACTGGATTACTCGAGTAATCCAGTTTAGAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024551.2-245s21c1
Sequence:CCGGGCCAGATATAAGGCTCAGAAACTCGAGTTTCTGAGCCTTATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-245s1c1
Sequence:CCGGGCCAGATATAAGGCTCAGAAACTCGAGTTTCTGAGCCTTATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-930s1c1
Sequence:CCGGCCTTGCTTCATCTACTTGATTCTCGAGAATCAAGTAGATGAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-836s1c1
Sequence:CCGGGCTCTTCTCTAAACTGGATTACTCGAGTAATCCAGTTTAGAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024551.2-1054s1c1
Sequence:CCGGGCCTGAGTGGAATCATTCCTACTCGAGTAGGAATGATTCCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197985
VALIDATED
ADIPOR2 MISSION shRNA Bacterial Glycerol Stock
adiponectin receptor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-1259s21c1
Sequence:CCGGGCAGGAATTTCGTTTCATGATCTCGAGATCATGAAACGAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-404s21c1
Sequence:CCGGCCATCATGCTATGGAACGAATCTCGAGATTCGTTCCATAGCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-190s21c1
Sequence:CCGGGGACTCCAGAGCCAGATATACCTCGAGGTATATCTGGCTCTGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-1098s21c1
Sequence:CCGGCTTATGGCTAGCCTCTATATCCTCGAGGATATAGAGGCTAGCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197985.3-1613s21c1
Sequence:CCGGCTTCTGATGTGATCGTATTTACTCGAGTAAATACGATCACATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-2816s1c1
Sequence:CCGGCGGATAGAATTAAACCCACAACTCGAGTTGTGGGTTTAATTCTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-1259s1c1
Sequence:CCGGGCAGGAATTTCGTTTCATGATCTCGAGATCATGAAACGAAATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-3697s1c1
Sequence:CCGGGCACACATTTCAGTCTCCTTTCTCGAGAAAGGAGACTGAAATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-404s1c1
Sequence:CCGGCCATCATGCTATGGAACGAATCTCGAGATTCGTTCCATAGCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197985
VALIDATED
ADIPOR2 MISSION shRNA shRNA Plasmid DNA
adiponectin receptor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-1259s21c1
Sequence:CCGGGCAGGAATTTCGTTTCATGATCTCGAGATCATGAAACGAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-404s21c1
Sequence:CCGGCCATCATGCTATGGAACGAATCTCGAGATTCGTTCCATAGCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-190s21c1
Sequence:CCGGGGACTCCAGAGCCAGATATACCTCGAGGTATATCTGGCTCTGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-1098s21c1
Sequence:CCGGCTTATGGCTAGCCTCTATATCCTCGAGGATATAGAGGCTAGCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197985.3-1613s21c1
Sequence:CCGGCTTCTGATGTGATCGTATTTACTCGAGTAAATACGATCACATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-2816s1c1
Sequence:CCGGCGGATAGAATTAAACCCACAACTCGAGTTGTGGGTTTAATTCTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-1259s1c1
Sequence:CCGGGCAGGAATTTCGTTTCATGATCTCGAGATCATGAAACGAAATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-3697s1c1
Sequence:CCGGGCACACATTTCAGTCTCCTTTCTCGAGAAAGGAGACTGAAATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-404s1c1
Sequence:CCGGCCATCATGCTATGGAACGAATCTCGAGATTCGTTCCATAGCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197985
VALIDATED
ADIPOR2 MISSION shRNA Lentiviral Transduction Particles
adiponectin receptor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-1259s21c1
Sequence:CCGGGCAGGAATTTCGTTTCATGATCTCGAGATCATGAAACGAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-404s21c1
Sequence:CCGGCCATCATGCTATGGAACGAATCTCGAGATTCGTTCCATAGCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-190s21c1
Sequence:CCGGGGACTCCAGAGCCAGATATACCTCGAGGTATATCTGGCTCTGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197985.3-1098s21c1
Sequence:CCGGCTTATGGCTAGCCTCTATATCCTCGAGGATATAGAGGCTAGCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197985.3-1613s21c1
Sequence:CCGGCTTCTGATGTGATCGTATTTACTCGAGTAAATACGATCACATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-2816s1c1
Sequence:CCGGCGGATAGAATTAAACCCACAACTCGAGTTGTGGGTTTAATTCTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-1259s1c1
Sequence:CCGGGCAGGAATTTCGTTTCATGATCTCGAGATCATGAAACGAAATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-3697s1c1
Sequence:CCGGGCACACATTTCAGTCTCCTTTCTCGAGAAAGGAGACTGAAATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197985.2-404s1c1
Sequence:CCGGCCATCATGCTATGGAACGAATCTCGAGATTCGTTCCATAGCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks