EMAIL THIS PAGE TO A FRIEND

ADIRF

adipogenesis regulatory factor

27 Gene Product Result for
Synonyms: AFRO APM2 C10orf116 apM-2
Species: Human ADIRF(10974), chicken ADIRF(768752)
UniProtKB ID: Q15847
Gene ID:
Human(10974) Summary: APM2 gene is exclusively expressed in adipose tissue. Its function is currently unknown. [provided by RefSeq, Jul 2008]
chicken(768752) adipogenesis regulatory factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006829 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118881 MISSION® esiRNA esiRNA human C10orf116 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006829 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146612 predicted 253
2 SASI_Hs02_00342390 predicted 345
3 SASI_Hs01_00146613 predicted 353
4 SASI_Hs01_00146614 predicted 255
5 SASI_Hs01_00146615 predicted 439
6 SASI_Hs01_00146616 predicted 294
7 SASI_Hs01_00146617 predicted 289
8 SASI_Hs01_00146619 predicted 259
9 SASI_Hs01_00146620 predicted 267
10 SASI_Hs01_00146621 predicted 276
11 SASI_Hs01_00146618 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006829
VALIDATED
ADIRF MISSION shRNA Bacterial Glycerol Stock
adipogenesis regulatory factor
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000074468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006829.2-495s1c1
Sequence:CCGGCCCTGTGTCCACTTCATGATTCTCGAGAATCATGAAGTGGACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006829.2-273s1c1
Sequence:CCGGCATCGACAAGACTGCTAACCACTCGAGTGGTTAGCAGTCTTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006829.2-261s1c1
Sequence:CCGGCACCCAGGAAACCATCGACAACTCGAGTTGTCGATGGTTTCCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006829.2-202s1c1
Sequence:CCGGCAAGTGGTGGACCAGGCCACACTCGAGTGTGGCCTGGTCCACCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006829
VALIDATED
ADIRF MISSION shRNA shRNA Plasmid DNA
adipogenesis regulatory factor
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000074468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006829.2-495s1c1
Sequence:CCGGCCCTGTGTCCACTTCATGATTCTCGAGAATCATGAAGTGGACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006829.2-273s1c1
Sequence:CCGGCATCGACAAGACTGCTAACCACTCGAGTGGTTAGCAGTCTTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006829.2-261s1c1
Sequence:CCGGCACCCAGGAAACCATCGACAACTCGAGTTGTCGATGGTTTCCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006829.2-202s1c1
Sequence:CCGGCAAGTGGTGGACCAGGCCACACTCGAGTGTGGCCTGGTCCACCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006829
VALIDATED
ADIRF MISSION shRNA Lentiviral Transduction Particles
adipogenesis regulatory factor
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000074468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006829.2-495s1c1
Sequence:CCGGCCCTGTGTCCACTTCATGATTCTCGAGAATCATGAAGTGGACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006829.2-273s1c1
Sequence:CCGGCATCGACAAGACTGCTAACCACTCGAGTGGTTAGCAGTCTTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006829.2-261s1c1
Sequence:CCGGCACCCAGGAAACCATCGACAACTCGAGTTGTCGATGGTTTCCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006829.2-202s1c1
Sequence:CCGGCAAGTGGTGGACCAGGCCACACTCGAGTGTGGCCTGGTCCACCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks