EMAIL THIS PAGE TO A FRIEND

ADK

adenosine kinase

120 Gene Product Result for
Synonyms: AK
Gene ID:
Human(132) Summary: This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(11534) adenosine kinase
Rat(25368) adenosine kinase
Thale Cress(818302) adenosine kinase
chicken(423735) adenosine kinase
cow(783572) adenosine kinase
Horse(100072901) adenosine kinase
domestic cat(101089896) adenosine kinase
dog(479253) adenosine kinase
sheep(101122324) adenosine kinase
naked mole-rat(101719125) adenosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123 Rosetta Predictions human pricing
NM_006721 Rosetta Predictions human pricing
NM_012895 Rosetta Predictions rat pricing
NM_134079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105694 predicted 829
2 SASI_Hs01_00105696 predicted 898
3 SASI_Hs01_00105697 predicted 957
4 SASI_Hs01_00105698 predicted 506
5 SASI_Hs01_00105699 predicted 794
6 SASI_Hs01_00105700 predicted 1063
7 SASI_Hs01_00105701 predicted 1266
8 SASI_Hs01_00105702 predicted 1152
9 SASI_Hs02_00327656 predicted 821
10 SASI_Hs01_00105695 predicted 1318
11 SASI_Hs01_00105703 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246164 predicted 760
2 SASI_Hs01_00246166 predicted 842
3 SASI_Hs01_00246167 predicted 894
4 SASI_Hs01_00246168 predicted 450
5 SASI_Hs01_00246169 predicted 731
6 SASI_Hs01_00246170 predicted 1007
7 SASI_Hs01_00246171 predicted 1197
8 SASI_Hs01_00246172 predicted 1085
9 SASI_Hs02_00342157 predicted 759
10 SASI_Hs01_00246165 predicted 1261
11 SASI_Hs01_00246173 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110572 predicted 1167
2 SASI_Rn01_00110573 predicted 615
3 SASI_Rn01_00110574 predicted 990
4 SASI_Rn01_00110577 predicted 447
5 SASI_Rn01_00110578 predicted 545
6 SASI_Rn01_00110579 predicted 772
7 SASI_Rn01_00110580 predicted 861
8 SASI_Rn01_00110581 predicted 863
9 SASI_Rn02_00260421 predicted 482
10 SASI_Rn02_00260422 predicted 354
11 SASI_Rn01_00110575 predicted 841
12 SASI_Rn01_00110576 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192948 predicted 286
2 SASI_Mm02_00339289 predicted 858
3 SASI_Mm01_00192951 predicted 985
4 SASI_Mm01_00192949 predicted 646
5 SASI_Mm01_00192950 predicted 763
6 SASI_Mm02_00339290 predicted 1076
7 SASI_Mm01_00192952 predicted 361
8 SASI_Mm01_00192953 predicted 707
9 SASI_Mm02_00339291 predicted 414
10 SASI_Mm01_00192954 predicted 315
11 SASI_Mm01_00192947 predicted 333
12 SASI_Mm01_00192955 predicted 725
13 SASI_Mm01_00192956 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123
VALIDATED
ADK MISSION shRNA Bacterial Glycerol Stock
adenosine kinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001123.2-257s1c1
Sequence:CCGGGACAAAGATTTCCTTGATAAGCTCGAGCTTATCAAGGAAATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001123.2-1761s1c1
Sequence:CCGGCTCTTTAATGTGCACTCAAACCTCGAGGTTTGAGTGCACATTAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001123.x-360s1c1
Sequence:CCGGATATCATGCTGGTGGCTCTACCTCGAGGTAGAGCCACCAGCATGATATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001123.x-714s1c1
Sequence:CCGGGTCAGTATTAAAGGTGGCTCACTCGAGTGAGCCACCTTTAATACTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001123.x-901s1c1
Sequence:CCGGGACATTAAAGAGATAGCCAAACTCGAGTTTGGCTATCTCTTTAATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001123.x-523s1c1
Sequence:CCGGGAGCAGAATGAGCAGCCAACACTCGAGTGTTGGCTGCTCATTCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001123.x-991s1c1
Sequence:CCGGGACACTATAATGGCTACAGAACTCGAGTTCTGTAGCCATTATAGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123.2-985s21c1
Sequence:GTACCGGAGGGAGAGATGACACTATAATCTCGAGATTATAGTGTCATCTCTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123.2-527s21c1
Sequence:CCGGGAGCAGAATGAGCAGCCAACACTCGAGTGTTGGCTGCTCATTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123.2-774s21c1
Sequence:CCGGATCTATCTGCACCGTTTATTACTCGAGTAATAAACGGTGCAGATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123.2-1159s21c1
Sequence:CCGGCTATGCAGCAAGCATCATAATCTCGAGATTATGATGCTTGCTGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123.2-1442s21c1
Sequence:CCGGGCCACTTAAATGCCAATTAAACTCGAGTTTAATTGGCATTTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123.2-364s21c1
Sequence:CCGGATATCATGCTGGTGGCTCTACCTCGAGGTAGAGCCACCAGCATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123.2-1702s21c1
Sequence:GTACCGGATACACCTGATAGTCAAATAACTCGAGTTATTTGACTATCAGGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123
VALIDATED
ADK MISSION shRNA shRNA Plasmid DNA
adenosine kinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001123.2-257s1c1
Sequence:CCGGGACAAAGATTTCCTTGATAAGCTCGAGCTTATCAAGGAAATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001123.2-1761s1c1
Sequence:CCGGCTCTTTAATGTGCACTCAAACCTCGAGGTTTGAGTGCACATTAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001123.x-360s1c1
Sequence:CCGGATATCATGCTGGTGGCTCTACCTCGAGGTAGAGCCACCAGCATGATATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001123.x-714s1c1
Sequence:CCGGGTCAGTATTAAAGGTGGCTCACTCGAGTGAGCCACCTTTAATACTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001123.x-901s1c1
Sequence:CCGGGACATTAAAGAGATAGCCAAACTCGAGTTTGGCTATCTCTTTAATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001123.x-523s1c1
Sequence:CCGGGAGCAGAATGAGCAGCCAACACTCGAGTGTTGGCTGCTCATTCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001123.x-991s1c1
Sequence:CCGGGACACTATAATGGCTACAGAACTCGAGTTCTGTAGCCATTATAGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123.2-985s21c1
Sequence:GTACCGGAGGGAGAGATGACACTATAATCTCGAGATTATAGTGTCATCTCTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123.2-527s21c1
Sequence:CCGGGAGCAGAATGAGCAGCCAACACTCGAGTGTTGGCTGCTCATTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123.2-774s21c1
Sequence:CCGGATCTATCTGCACCGTTTATTACTCGAGTAATAAACGGTGCAGATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123.2-1159s21c1
Sequence:CCGGCTATGCAGCAAGCATCATAATCTCGAGATTATGATGCTTGCTGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123.2-1442s21c1
Sequence:CCGGGCCACTTAAATGCCAATTAAACTCGAGTTTAATTGGCATTTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123.2-364s21c1
Sequence:CCGGATATCATGCTGGTGGCTCTACCTCGAGGTAGAGCCACCAGCATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123.2-1702s21c1
Sequence:GTACCGGATACACCTGATAGTCAAATAACTCGAGTTATTTGACTATCAGGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123
VALIDATED
ADK MISSION shRNA Lentiviral Transduction Particles
adenosine kinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001123.2-257s1c1
Sequence:CCGGGACAAAGATTTCCTTGATAAGCTCGAGCTTATCAAGGAAATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001123.2-1761s1c1
Sequence:CCGGCTCTTTAATGTGCACTCAAACCTCGAGGTTTGAGTGCACATTAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001123.x-360s1c1
Sequence:CCGGATATCATGCTGGTGGCTCTACCTCGAGGTAGAGCCACCAGCATGATATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001123.x-714s1c1
Sequence:CCGGGTCAGTATTAAAGGTGGCTCACTCGAGTGAGCCACCTTTAATACTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001123.x-901s1c1
Sequence:CCGGGACATTAAAGAGATAGCCAAACTCGAGTTTGGCTATCTCTTTAATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001123.x-523s1c1
Sequence:CCGGGAGCAGAATGAGCAGCCAACACTCGAGTGTTGGCTGCTCATTCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001123.x-991s1c1
Sequence:CCGGGACACTATAATGGCTACAGAACTCGAGTTCTGTAGCCATTATAGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123.2-985s21c1
Sequence:GTACCGGAGGGAGAGATGACACTATAATCTCGAGATTATAGTGTCATCTCTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123.2-527s21c1
Sequence:CCGGGAGCAGAATGAGCAGCCAACACTCGAGTGTTGGCTGCTCATTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123.2-774s21c1
Sequence:CCGGATCTATCTGCACCGTTTATTACTCGAGTAATAAACGGTGCAGATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123.2-1159s21c1
Sequence:CCGGCTATGCAGCAAGCATCATAATCTCGAGATTATGATGCTTGCTGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123.2-1442s21c1
Sequence:CCGGGCCACTTAAATGCCAATTAAACTCGAGTTTAATTGGCATTTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123.2-364s21c1
Sequence:CCGGATATCATGCTGGTGGCTCTACCTCGAGGTAGAGCCACCAGCATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123.2-1702s21c1
Sequence:GTACCGGATACACCTGATAGTCAAATAACTCGAGTTATTTGACTATCAGGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134079
ADK MISSION shRNA Bacterial Glycerol Stock
adenosine kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-496s1c1
Sequence:CCGGGCCGCCAATTGTTACAAGAAACTCGAGTTTCTTGTAACAATTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-159s1c1
Sequence:CCGGCCTTGATAAGTATTCTCTGAACTCGAGTTCAGAGAATACTTATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-782s1c1
Sequence:CCGGGCTTTGAGACTAAAGACATTACTCGAGTAATGTCTTTAGTCTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-613s1c1
Sequence:CCGGGTATTGAAAGTGGCTCGCTATCTCGAGATAGCGAGCCACTTTCAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-589s21c1
Sequence:CCGGGTATTGAAAGTGGCTCGCTATCTCGAGATAGCGAGCCACTTTCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-472s21c1
Sequence:CCGGGCCGCCAATTGTTACAAGAAACTCGAGTTTCTTGTAACAATTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134079.3-1225s21c1
Sequence:CCGGGTGCTACTTCTAGGACCTTTACTCGAGTAAAGGTCCTAGAAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-135s21c1
Sequence:CCGGCCTTGATAAGTATTCTCTGAACTCGAGTTCAGAGAATACTTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-758s21c1
Sequence:CCGGGCTTTGAGACTAAAGACATTACTCGAGTAATGTCTTTAGTCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134079
ADK MISSION shRNA shRNA Plasmid DNA
adenosine kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-496s1c1
Sequence:CCGGGCCGCCAATTGTTACAAGAAACTCGAGTTTCTTGTAACAATTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-159s1c1
Sequence:CCGGCCTTGATAAGTATTCTCTGAACTCGAGTTCAGAGAATACTTATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-782s1c1
Sequence:CCGGGCTTTGAGACTAAAGACATTACTCGAGTAATGTCTTTAGTCTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-613s1c1
Sequence:CCGGGTATTGAAAGTGGCTCGCTATCTCGAGATAGCGAGCCACTTTCAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-589s21c1
Sequence:CCGGGTATTGAAAGTGGCTCGCTATCTCGAGATAGCGAGCCACTTTCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-472s21c1
Sequence:CCGGGCCGCCAATTGTTACAAGAAACTCGAGTTTCTTGTAACAATTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134079.3-1225s21c1
Sequence:CCGGGTGCTACTTCTAGGACCTTTACTCGAGTAAAGGTCCTAGAAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-135s21c1
Sequence:CCGGCCTTGATAAGTATTCTCTGAACTCGAGTTCAGAGAATACTTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-758s21c1
Sequence:CCGGGCTTTGAGACTAAAGACATTACTCGAGTAATGTCTTTAGTCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134079
ADK MISSION shRNA Lentiviral Transduction Particles
adenosine kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-496s1c1
Sequence:CCGGGCCGCCAATTGTTACAAGAAACTCGAGTTTCTTGTAACAATTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-159s1c1
Sequence:CCGGCCTTGATAAGTATTCTCTGAACTCGAGTTCAGAGAATACTTATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-782s1c1
Sequence:CCGGGCTTTGAGACTAAAGACATTACTCGAGTAATGTCTTTAGTCTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134079.1-613s1c1
Sequence:CCGGGTATTGAAAGTGGCTCGCTATCTCGAGATAGCGAGCCACTTTCAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-589s21c1
Sequence:CCGGGTATTGAAAGTGGCTCGCTATCTCGAGATAGCGAGCCACTTTCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-472s21c1
Sequence:CCGGGCCGCCAATTGTTACAAGAAACTCGAGTTTCTTGTAACAATTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134079.3-1225s21c1
Sequence:CCGGGTGCTACTTCTAGGACCTTTACTCGAGTAAAGGTCCTAGAAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-135s21c1
Sequence:CCGGCCTTGATAAGTATTCTCTGAACTCGAGTTCAGAGAATACTTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134079.3-758s21c1
Sequence:CCGGGCTTTGAGACTAAAGACATTACTCGAGTAATGTCTTTAGTCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks