EMAIL THIS PAGE TO A FRIEND

ADM2

adrenomedullin 2

46 Gene Product Result for
Synonyms: AM2 dJ579N16.4
UniProtKB ID: Q7Z4H4, Q3LFQ0
Gene ID:
Human(79924) Summary: This gene encodes a protein which is a member of the calcitonin-related hormones. The encoded protein is involved in maintaining homeostasis in many tissues, acting via CRLR/RAMP receptor (calcitonin receptor-like receptor/receptor activity-modifying protein) complexes. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
Mouse(223780) adrenomedullin 2
Rat(399475) adrenomedullin 2
chicken(101668911) adrenomedullin 2
cow(618896) adrenomedullin 2
dog(606919) adrenomedullin 2
chicken(101751391) adrenomedullin 2
naked mole-rat(101701608) adrenomedullin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024866 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024866 Rosetta Predictions human pricing
NM_201426 Rosetta Predictions rat pricing
NM_182928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019822 predicted 895
2 SASI_Hs01_00019823 predicted 851
3 SASI_Hs01_00019824 predicted 1728
4 SASI_Hs01_00019825 predicted 3402
5 SASI_Hs01_00019826 predicted 3405
6 SASI_Hs01_00019827 predicted 1783
7 SASI_Hs01_00019828 predicted 3216
8 SASI_Hs02_00357453 predicted 1490
9 SASI_Hs01_00019829 predicted 3738
10 SASI_Hs01_00019830 predicted 2091
11 SASI_Hs01_00019831 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092343 predicted 754
2 SASI_Rn01_00092344 predicted 737
3 SASI_Rn01_00092345 predicted 714
4 SASI_Rn01_00092346 predicted 505
5 SASI_Rn01_00092347 predicted 197
6 SASI_Rn01_00092349 predicted 723
7 SASI_Rn01_00092350 predicted 721
8 SASI_Rn01_00092352 predicted 491
9 SASI_Rn02_00270329 predicted 516
10 SASI_Rn02_00270330 predicted 634
11 SASI_Rn01_00092348 predicted 769
12 SASI_Rn01_00092351 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031613 predicted 333
2 SASI_Mm01_00031614 predicted 287
3 SASI_Mm01_00031615 predicted 507
4 SASI_Mm01_00031616 predicted 387
5 SASI_Mm01_00031617 predicted 293
6 SASI_Mm01_00031618 predicted 620
7 SASI_Mm01_00031619 predicted 721
8 SASI_Mm01_00031620 predicted 346
9 SASI_Mm01_00031621 predicted 676
10 SASI_Mm01_00031622 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182928
ADM2 MISSION shRNA Bacterial Glycerol Stock
adrenomedullin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182928.3-942s1c1
Sequence:CCGGCCTATGAATAAGCAGGAAGAACTCGAGTTCTTCCTGCTTATTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197559    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182928.3-757s1c1
Sequence:CCGGCTATGAGGATATGTGGATCTACTCGAGTAGATCCACATATCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182928.3-302s1c1
Sequence:CCGGGATTCCTTCCAGTAACCTGCACTCGAGTGCAGGTTACTGGAAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-399s21c1
Sequence:CCGGAGGGCCCTTGCTATGGTTCATCTCGAGATGAACCATAGCAAGGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-351s21c1
Sequence:CCGGGTCTGGAAGTCTCGTCGTCATCTCGAGATGACGACGAGACTTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182928.3-931s21c1
Sequence:CCGGATGCATCTCTACCTATGAATACTCGAGTATTCATAGGTAGAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182928.3-520s1c1
Sequence:CCGGCATGCCAAGTCCAGAATCTTACTCGAGTAAGATTCTGGACTTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-521s21c1
Sequence:CCGGATGCCAAGTCCAGAATCTTAGCTCGAGCTAAGATTCTGGACTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-297s21c1
Sequence:CCGGGCTAAGATTCCTTCCAGTAACCTCGAGGTTACTGGAAGGAATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182928
ADM2 MISSION shRNA shRNA Plasmid DNA
adrenomedullin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182928.3-942s1c1
Sequence:CCGGCCTATGAATAAGCAGGAAGAACTCGAGTTCTTCCTGCTTATTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197559    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182928.3-757s1c1
Sequence:CCGGCTATGAGGATATGTGGATCTACTCGAGTAGATCCACATATCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182928.3-302s1c1
Sequence:CCGGGATTCCTTCCAGTAACCTGCACTCGAGTGCAGGTTACTGGAAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-399s21c1
Sequence:CCGGAGGGCCCTTGCTATGGTTCATCTCGAGATGAACCATAGCAAGGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-351s21c1
Sequence:CCGGGTCTGGAAGTCTCGTCGTCATCTCGAGATGACGACGAGACTTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182928.3-931s21c1
Sequence:CCGGATGCATCTCTACCTATGAATACTCGAGTATTCATAGGTAGAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182928.3-520s1c1
Sequence:CCGGCATGCCAAGTCCAGAATCTTACTCGAGTAAGATTCTGGACTTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-521s21c1
Sequence:CCGGATGCCAAGTCCAGAATCTTAGCTCGAGCTAAGATTCTGGACTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-297s21c1
Sequence:CCGGGCTAAGATTCCTTCCAGTAACCTCGAGGTTACTGGAAGGAATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182928
ADM2 MISSION shRNA Lentiviral Transduction Particles
adrenomedullin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182928.3-942s1c1
Sequence:CCGGCCTATGAATAAGCAGGAAGAACTCGAGTTCTTCCTGCTTATTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197559    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182928.3-757s1c1
Sequence:CCGGCTATGAGGATATGTGGATCTACTCGAGTAGATCCACATATCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182928.3-302s1c1
Sequence:CCGGGATTCCTTCCAGTAACCTGCACTCGAGTGCAGGTTACTGGAAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-399s21c1
Sequence:CCGGAGGGCCCTTGCTATGGTTCATCTCGAGATGAACCATAGCAAGGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-351s21c1
Sequence:CCGGGTCTGGAAGTCTCGTCGTCATCTCGAGATGACGACGAGACTTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182928.3-931s21c1
Sequence:CCGGATGCATCTCTACCTATGAATACTCGAGTATTCATAGGTAGAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182928.3-520s1c1
Sequence:CCGGCATGCCAAGTCCAGAATCTTACTCGAGTAAGATTCTGGACTTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-521s21c1
Sequence:CCGGATGCCAAGTCCAGAATCTTAGCTCGAGCTAAGATTCTGGACTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182928.3-297s21c1
Sequence:CCGGGCTAAGATTCCTTCCAGTAACCTCGAGGTTACTGGAAGGAATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024866
ADM2 MISSION shRNA Bacterial Glycerol Stock
adrenomedullin 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-1431s1c1
Sequence:CCGGCCCAAGTGACAGCAAGAACAACTCGAGTTGTTCTTGCTGTCACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-636s1c1
Sequence:CCGGCAACAATACCTGCACGGCTTTCTCGAGAAAGCCGTGCAGGTATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-2983s1c1
Sequence:CCGGCCTTCACACCTTCCTCTGAATCTCGAGATTCAGAGGAAGGTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-3420s1c1
Sequence:CCGGGAAGCCCAGAACTCTGATCTTCTCGAGAAGATCAGAGTTCTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-1588s1c1
Sequence:CCGGCGAACACTGAGCATTTAATTTCTCGAGAAATTAAATGCTCAGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-1587s1c1
Sequence:CCGGGCGAACACTGAGCATTTAATTCTCGAGAATTAAATGCTCAGTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-3773s1c1
Sequence:CCGGGTTAGCAAGAATCCTCTAAATCTCGAGATTTAGAGGATTCTTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024866.3-704s1c1
Sequence:CCGGGAGCCTAAACACCCTGAAATTCTCGAGAATTTCAGGGTGTTTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024866.4-433s21c1
Sequence:CCGGACCTGTGGTCTGGAAGCTTCACTCGAGTGAAGCTTCCAGACCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024866.4-618s21c1
Sequence:CCGGAGAATCTCAGCCACCGCCTGTCTCGAGACAGGCGGTGGCTGAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024866.4-963s21c1
Sequence:CCGGCACCAGATGCTAAGCGCTTCACTCGAGTGAAGCGCTTAGCATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024866.4-845s21c1
Sequence:CCGGACGGCTTTGCACACGTAAACCCTCGAGGGTTTACGTGTGCAAAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024866
ADM2 MISSION shRNA shRNA Plasmid DNA
adrenomedullin 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-1431s1c1
Sequence:CCGGCCCAAGTGACAGCAAGAACAACTCGAGTTGTTCTTGCTGTCACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-636s1c1
Sequence:CCGGCAACAATACCTGCACGGCTTTCTCGAGAAAGCCGTGCAGGTATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-2983s1c1
Sequence:CCGGCCTTCACACCTTCCTCTGAATCTCGAGATTCAGAGGAAGGTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-3420s1c1
Sequence:CCGGGAAGCCCAGAACTCTGATCTTCTCGAGAAGATCAGAGTTCTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-1588s1c1
Sequence:CCGGCGAACACTGAGCATTTAATTTCTCGAGAAATTAAATGCTCAGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-1587s1c1
Sequence:CCGGGCGAACACTGAGCATTTAATTCTCGAGAATTAAATGCTCAGTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-3773s1c1
Sequence:CCGGGTTAGCAAGAATCCTCTAAATCTCGAGATTTAGAGGATTCTTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024866.3-704s1c1
Sequence:CCGGGAGCCTAAACACCCTGAAATTCTCGAGAATTTCAGGGTGTTTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024866.4-433s21c1
Sequence:CCGGACCTGTGGTCTGGAAGCTTCACTCGAGTGAAGCTTCCAGACCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024866.4-618s21c1
Sequence:CCGGAGAATCTCAGCCACCGCCTGTCTCGAGACAGGCGGTGGCTGAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024866.4-963s21c1
Sequence:CCGGCACCAGATGCTAAGCGCTTCACTCGAGTGAAGCGCTTAGCATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024866.4-845s21c1
Sequence:CCGGACGGCTTTGCACACGTAAACCCTCGAGGGTTTACGTGTGCAAAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024866
ADM2 MISSION shRNA Lentiviral Transduction Particles
adrenomedullin 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-1431s1c1
Sequence:CCGGCCCAAGTGACAGCAAGAACAACTCGAGTTGTTCTTGCTGTCACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-636s1c1
Sequence:CCGGCAACAATACCTGCACGGCTTTCTCGAGAAAGCCGTGCAGGTATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-2983s1c1
Sequence:CCGGCCTTCACACCTTCCTCTGAATCTCGAGATTCAGAGGAAGGTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-3420s1c1
Sequence:CCGGGAAGCCCAGAACTCTGATCTTCTCGAGAAGATCAGAGTTCTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-1588s1c1
Sequence:CCGGCGAACACTGAGCATTTAATTTCTCGAGAAATTAAATGCTCAGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-1587s1c1
Sequence:CCGGGCGAACACTGAGCATTTAATTCTCGAGAATTAAATGCTCAGTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024866.3-3773s1c1
Sequence:CCGGGTTAGCAAGAATCCTCTAAATCTCGAGATTTAGAGGATTCTTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024866.3-704s1c1
Sequence:CCGGGAGCCTAAACACCCTGAAATTCTCGAGAATTTCAGGGTGTTTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024866.4-433s21c1
Sequence:CCGGACCTGTGGTCTGGAAGCTTCACTCGAGTGAAGCTTCCAGACCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024866.4-618s21c1
Sequence:CCGGAGAATCTCAGCCACCGCCTGTCTCGAGACAGGCGGTGGCTGAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024866.4-963s21c1
Sequence:CCGGCACCAGATGCTAAGCGCTTCACTCGAGTGAAGCGCTTAGCATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024866.4-845s21c1
Sequence:CCGGACGGCTTTGCACACGTAAACCCTCGAGGGTTTACGTGTGCAAAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks