EMAIL THIS PAGE TO A FRIEND

ADM

adrenomedullin

135 Gene Product Result for
Synonyms: AM
UniProtKB ID: P35318, B2R793, D3DQV3, Q6FGW2
Gene ID:
Human(133) Summary: Adrenomedullin, a hypotensive peptide found in human pheochromocytoma, consists of 52 amino acids, has 1 intramolecular disulfide bond, and shows a slight homology with the calcitonin gene-related peptide. It may function as a hormone in circulation control because it is found in blood in a considerable concentration. The precursor, called preproadrenomedullin, is 185 amino acids long. By RNA-blot analysis, human adrenomedullin mRNA was found to be highly expressed in several tissues. Genomic ADM DNA consists of 4 exons and 3 introns, with the 5-prime flanking region containing TATA, CAAT, and GC boxes. There are also multiple binding sites for activator protein-2 and a cAMP-regulated enhancer element. [provided by RefSeq, Jul 2008]
Mouse(11535) adrenomedullin
Rat(25026) adrenomedullin
fruit fly(250086) all discs missing
domestic cat(101087095) adrenomedullin
cow(280713) adrenomedullin
dog(403817) adrenomedullin
chicken(423042) adrenomedullin
naked mole-rat(101705917) adrenomedullin
sheep(101103753) adrenomedullin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001124 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043091 MISSION® esiRNA esiRNA human ADM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001124 Rosetta Predictions human pricing
NM_012715 Rosetta Predictions rat pricing
NM_009627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129196 predicted 208
2 SASI_Hs01_00129197 predicted 232
3 SASI_Hs01_00129198 predicted 219
4 SASI_Hs01_00129199 predicted 847
5 SASI_Hs01_00129200 predicted 312
6 SASI_Hs01_00129201 predicted 845
7 SASI_Hs01_00129202 predicted 225
8 SASI_Hs01_00129203 predicted 335
9 SASI_Hs01_00129205 predicted 332
10 SASI_Hs02_00327943 predicted 854
11 SASI_Hs01_00129204 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097361 predicted 242
2 SASI_Rn01_00097362 predicted 516
3 SASI_Rn02_00260052 predicted 412
4 SASI_Rn01_00097363 predicted 418
5 SASI_Rn01_00097364 predicted 762
6 SASI_Rn01_00097365 predicted 700
7 SASI_Rn01_00097366 predicted 574
8 SASI_Rn01_00097367 predicted 532
9 SASI_Rn01_00097368 predicted 505
10 SASI_Rn01_00097369 predicted 577
11 SASI_Rn01_00097370 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053470 predicted 699
2 SASI_Mm01_00053471 predicted 523
3 SASI_Mm01_00053472 predicted 416
4 SASI_Mm01_00053473 predicted 420
5 SASI_Mm01_00053474 predicted 245
6 SASI_Mm01_00053475 predicted 200
7 SASI_Mm01_00053476 predicted 699
8 SASI_Mm02_00316580 predicted 542
9 SASI_Mm01_00053478 predicted 581
10 SASI_Mm01_00053479 predicted 739
11 SASI_Mm01_00053477 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009627
VALIDATED
ADM MISSION shRNA Bacterial Glycerol Stock
adrenomedullin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009627.1-262s21c1
Sequence:CCGGGTTCCGAAAGAAGTGGAATAACTCGAGTTATTCCACTTCTTTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009627.1-710s21c1
Sequence:CCGGTCCAGACTCTTTAGGATATAGCTCGAGCTATATCCTAAAGAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009627.1-540s21c1
Sequence:CCGGTCTACCAGCTAACAGACAAAGCTCGAGCTTTGTCTGTTAGCTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009627.1-365s21c1
Sequence:CCGGACCCAGACTCTTGATCCATTCCTCGAGGAATGGATCAAGAGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009627.1-1033s21c1
Sequence:CCGGGTCCAGCCAAAGGTAACTATACTCGAGTATAGTTACCTTTGGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009627.1-979s1c1
Sequence:CCGGCCTCATTACTACTTGAACTTTCTCGAGAAAGTTCAAGTAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-581s1c1
Sequence:CCGGAGAAACAAGATCAGCCCTCAACTCGAGTTGAGGGCTGATCTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-259s1c1
Sequence:CCGGGCAGTTCCGAAAGAAGTGGAACTCGAGTTCCACTTCTTTCGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-434s1c1
Sequence:CCGGGAAGCCCACATTCGTGTCAAACTCGAGTTTGACACGAATGTGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-530s1c1
Sequence:CCGGGCCCACCAGATCTACCAGCTACTCGAGTAGCTGGTAGATCTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009627
VALIDATED
ADM MISSION shRNA shRNA Plasmid DNA
adrenomedullin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009627.1-262s21c1
Sequence:CCGGGTTCCGAAAGAAGTGGAATAACTCGAGTTATTCCACTTCTTTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009627.1-710s21c1
Sequence:CCGGTCCAGACTCTTTAGGATATAGCTCGAGCTATATCCTAAAGAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009627.1-540s21c1
Sequence:CCGGTCTACCAGCTAACAGACAAAGCTCGAGCTTTGTCTGTTAGCTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009627.1-365s21c1
Sequence:CCGGACCCAGACTCTTGATCCATTCCTCGAGGAATGGATCAAGAGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009627.1-1033s21c1
Sequence:CCGGGTCCAGCCAAAGGTAACTATACTCGAGTATAGTTACCTTTGGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009627.1-979s1c1
Sequence:CCGGCCTCATTACTACTTGAACTTTCTCGAGAAAGTTCAAGTAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-581s1c1
Sequence:CCGGAGAAACAAGATCAGCCCTCAACTCGAGTTGAGGGCTGATCTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-259s1c1
Sequence:CCGGGCAGTTCCGAAAGAAGTGGAACTCGAGTTCCACTTCTTTCGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-434s1c1
Sequence:CCGGGAAGCCCACATTCGTGTCAAACTCGAGTTTGACACGAATGTGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-530s1c1
Sequence:CCGGGCCCACCAGATCTACCAGCTACTCGAGTAGCTGGTAGATCTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009627
VALIDATED
ADM MISSION shRNA Lentiviral Transduction Particles
adrenomedullin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009627.1-262s21c1
Sequence:CCGGGTTCCGAAAGAAGTGGAATAACTCGAGTTATTCCACTTCTTTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009627.1-710s21c1
Sequence:CCGGTCCAGACTCTTTAGGATATAGCTCGAGCTATATCCTAAAGAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009627.1-540s21c1
Sequence:CCGGTCTACCAGCTAACAGACAAAGCTCGAGCTTTGTCTGTTAGCTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009627.1-365s21c1
Sequence:CCGGACCCAGACTCTTGATCCATTCCTCGAGGAATGGATCAAGAGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009627.1-1033s21c1
Sequence:CCGGGTCCAGCCAAAGGTAACTATACTCGAGTATAGTTACCTTTGGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009627.1-979s1c1
Sequence:CCGGCCTCATTACTACTTGAACTTTCTCGAGAAAGTTCAAGTAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-581s1c1
Sequence:CCGGAGAAACAAGATCAGCCCTCAACTCGAGTTGAGGGCTGATCTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-259s1c1
Sequence:CCGGGCAGTTCCGAAAGAAGTGGAACTCGAGTTCCACTTCTTTCGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-434s1c1
Sequence:CCGGGAAGCCCACATTCGTGTCAAACTCGAGTTTGACACGAATGTGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009627.1-530s1c1
Sequence:CCGGGCCCACCAGATCTACCAGCTACTCGAGTAGCTGGTAGATCTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001124
VALIDATED
ADM MISSION shRNA Bacterial Glycerol Stock
adrenomedullin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001124.1-1143s21c1
Sequence:CCGGGTACATACAGAGGTAACTATCCTCGAGGATAGTTACCTCTGTATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124.1-701s21c1
Sequence:CCGGCCCACTTTCTTTAGGATTTAGCTCGAGCTAAATCCTAAAGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124.1-281s21c1
Sequence:CCGGGGAAGAGGGAACTGCGGATGTCTCGAGACATCCGCAGTTCCCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124.1-371s21c1
Sequence:CCGGACATGAAGGGTGCCTCTCGAACTCGAGTTCGAGAGGCACCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001124.1-525s21c1
Sequence:CCGGGATCTACCAGTTCACAGATAACTCGAGTTATCTGTGAACTGGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001124.1-643s1c1
Sequence:CCGGCTGGTGTCTTCTAAGCCACAACTCGAGTTGTGGCTTAGAAGACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001124.1-236s1c1
Sequence:CCGGCGTCGGAGTTTCGAAAGAAGTCTCGAGACTTCTTTCGAAACTCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001124.1-243s1c1
Sequence:CCGGGTTTCGAAAGAAGTGGAATAACTCGAGTTATTCCACTTCTTTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001124.1-441s1c1
Sequence:CCGGCCGCCAGAGCATGAACAACTTCTCGAGAAGTTGTTCATGCTCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001124.1-1088s1c1
Sequence:CCGGCCTCACTATTACTTGAACTTTCTCGAGAAAGTTCAAGTAATAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001124
VALIDATED
ADM MISSION shRNA shRNA Plasmid DNA
adrenomedullin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001124.1-1143s21c1
Sequence:CCGGGTACATACAGAGGTAACTATCCTCGAGGATAGTTACCTCTGTATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124.1-701s21c1
Sequence:CCGGCCCACTTTCTTTAGGATTTAGCTCGAGCTAAATCCTAAAGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124.1-281s21c1
Sequence:CCGGGGAAGAGGGAACTGCGGATGTCTCGAGACATCCGCAGTTCCCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124.1-371s21c1
Sequence:CCGGACATGAAGGGTGCCTCTCGAACTCGAGTTCGAGAGGCACCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001124.1-525s21c1
Sequence:CCGGGATCTACCAGTTCACAGATAACTCGAGTTATCTGTGAACTGGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001124.1-643s1c1
Sequence:CCGGCTGGTGTCTTCTAAGCCACAACTCGAGTTGTGGCTTAGAAGACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001124.1-236s1c1
Sequence:CCGGCGTCGGAGTTTCGAAAGAAGTCTCGAGACTTCTTTCGAAACTCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001124.1-243s1c1
Sequence:CCGGGTTTCGAAAGAAGTGGAATAACTCGAGTTATTCCACTTCTTTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001124.1-441s1c1
Sequence:CCGGCCGCCAGAGCATGAACAACTTCTCGAGAAGTTGTTCATGCTCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001124.1-1088s1c1
Sequence:CCGGCCTCACTATTACTTGAACTTTCTCGAGAAAGTTCAAGTAATAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001124
VALIDATED
ADM MISSION shRNA Lentiviral Transduction Particles
adrenomedullin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001124.1-1143s21c1
Sequence:CCGGGTACATACAGAGGTAACTATCCTCGAGGATAGTTACCTCTGTATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124.1-701s21c1
Sequence:CCGGCCCACTTTCTTTAGGATTTAGCTCGAGCTAAATCCTAAAGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124.1-281s21c1
Sequence:CCGGGGAAGAGGGAACTGCGGATGTCTCGAGACATCCGCAGTTCCCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124.1-371s21c1
Sequence:CCGGACATGAAGGGTGCCTCTCGAACTCGAGTTCGAGAGGCACCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001124.1-525s21c1
Sequence:CCGGGATCTACCAGTTCACAGATAACTCGAGTTATCTGTGAACTGGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001124.1-643s1c1
Sequence:CCGGCTGGTGTCTTCTAAGCCACAACTCGAGTTGTGGCTTAGAAGACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001124.1-236s1c1
Sequence:CCGGCGTCGGAGTTTCGAAAGAAGTCTCGAGACTTCTTTCGAAACTCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001124.1-243s1c1
Sequence:CCGGGTTTCGAAAGAAGTGGAATAACTCGAGTTATTCCACTTCTTTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001124.1-441s1c1
Sequence:CCGGCCGCCAGAGCATGAACAACTTCTCGAGAAGTTGTTCATGCTCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001124.1-1088s1c1
Sequence:CCGGCCTCACTATTACTTGAACTTTCTCGAGAAAGTTCAAGTAATAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks