EMAIL THIS PAGE TO A FRIEND

ADNP2

ADNP homeobox 2

Synonyms: ZNF508
UniProtKB ID: Q6IQ32, A8K951, O94943, Q9H9P3
Gene ID:
Mouse(240442) ADNP homeobox 2
Rat(307236) ADNP homeobox 2
sheep(101121903) ADNP homeobox 2
Domestic Rabbit(100349304) ADNP homeobox 2
chicken(420805) ADNP homeobox 2
dog(100686027) ADNP homeobox 2
domestic cat(101080581) ADNP homeobox 2
cow(504380) ADNP homeobox 2
Horse(100065519) ADNP homeobox 2
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_377498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_377498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_377498 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014913 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014913 Rosetta Predictions human pricing
NM_001127373 Rosetta Predictions rat pricing
NM_175028 Rosetta Predictions mouse pricing
XM_140497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021624 predicted 1044
2 SASI_Hs01_00021627 predicted 644
3 SASI_Hs01_00021628 predicted 900
4 SASI_Hs01_00021629 predicted 653
5 SASI_Hs01_00021630 predicted 1185
6 SASI_Hs01_00021631 predicted 1171
7 SASI_Hs02_00346554 predicted 887
8 SASI_Hs02_00346555 predicted 615
9 SASI_Hs01_00021632 predicted 2050
10 SASI_Hs01_00021633 predicted 1000
11 SASI_Hs01_00021625 predicted 2175
12 SASI_Hs01_00021626 predicted 3530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253683 predicted 3678
2 SASI_Rn02_00253684 predicted 1415
3 SASI_Rn02_00253685 predicted 2641
4 SASI_Rn02_00253686 predicted 3464
5 SASI_Rn02_00253687 predicted 1089
6 SASI_Rn02_00253688 predicted 723
7 SASI_Rn02_00253689 predicted 1871
8 SASI_Rn02_00253690 predicted 904
9 SASI_Rn02_00253691 predicted 1857
10 SASI_Rn02_00253692 predicted 2046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345624 predicted 538
2 SASI_Mm02_00345625 predicted 3536
3 SASI_Mm02_00345626 predicted 3374
4 SASI_Mm02_00345627 predicted 2185
5 SASI_Mm02_00345628 predicted 3208
6 SASI_Mm02_00345629 predicted 3410
7 SASI_Mm02_00345630 predicted 754
8 SASI_Mm02_00345631 predicted 3010
9 SASI_Mm02_00345632 predicted 1443
10 SASI_Mm02_00345633 predicted 2603
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222134 predicted 3838
2 SASI_Mm01_00222135 predicted 3738
3 SASI_Mm01_00222136 predicted 3581
4 SASI_Mm01_00222137 predicted 3419
5 SASI_Mm01_00222138 predicted 3607
6 SASI_Mm01_00222139 predicted 3793
7 SASI_Mm01_00222140 predicted 3215
8 SASI_Mm01_00222141 predicted 3272
9 SASI_Mm01_00222142 predicted 3370
10 SASI_Mm01_00222143 predicted 3273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377498
VALIDATED
ADNP2 MISSION shRNA Bacterial Glycerol Stock
ADNP homeobox 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000021694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377498.1-175s1c1
Sequence:CCGGCCGTTAAAGATGAGGAGACAACTCGAGTTGTCTCCTCATCTTTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377498.1-842s1c1
Sequence:CCGGGCGATGTGATAAGTTTCACATCTCGAGATGTGAAACTTATCACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:XM_377498.1-620s1c1
Sequence:CCGGGCCTCTGTAAATACTCTACAACTCGAGTTGTAGAGTATTTACAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:XM_377498.1-1477s1c1
Sequence:CCGGCCACTTCATCAGTCTGTGAATCTCGAGATTCACAGACTGATGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377498
VALIDATED
ADNP2 MISSION shRNA shRNA Plasmid DNA
ADNP homeobox 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000021694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377498.1-175s1c1
Sequence:CCGGCCGTTAAAGATGAGGAGACAACTCGAGTTGTCTCCTCATCTTTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377498.1-842s1c1
Sequence:CCGGGCGATGTGATAAGTTTCACATCTCGAGATGTGAAACTTATCACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:XM_377498.1-620s1c1
Sequence:CCGGGCCTCTGTAAATACTCTACAACTCGAGTTGTAGAGTATTTACAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:XM_377498.1-1477s1c1
Sequence:CCGGCCACTTCATCAGTCTGTGAATCTCGAGATTCACAGACTGATGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377498
VALIDATED
ADNP2 MISSION shRNA Lentiviral Transduction Particles
ADNP homeobox 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000021694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377498.1-175s1c1
Sequence:CCGGCCGTTAAAGATGAGGAGACAACTCGAGTTGTCTCCTCATCTTTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377498.1-842s1c1
Sequence:CCGGGCGATGTGATAAGTTTCACATCTCGAGATGTGAAACTTATCACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:XM_377498.1-620s1c1
Sequence:CCGGGCCTCTGTAAATACTCTACAACTCGAGTTGTAGAGTATTTACAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:XM_377498.1-1477s1c1
Sequence:CCGGCCACTTCATCAGTCTGTGAATCTCGAGATTCACAGACTGATGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175028
VALIDATED
ADNP2 MISSION shRNA Bacterial Glycerol Stock
ADNP homeobox 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175028.1-226s21c1
Sequence:CCGGGGAGCTGATGAAGGATCTTAACTCGAGTTAAGATCCTTCATCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175028.1-3880s21c1
Sequence:GTACCGGACAGCCTGCAATCTACAAATACTCGAGTATTTGTAGATTGCAGGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175028.1-3491s21c1
Sequence:CCGGTTTGGGAAGAGAAGGTATATTCTCGAGAATATACCTTCTCTTCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175028.1-813s21c1
Sequence:CCGGACGCCCTGATGTATCACATTTCTCGAGAAATGTGATACATCAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175028.1-586s21c1
Sequence:CCGGGATAAGCTTCACGTGTCTAAACTCGAGTTTAGACACGTGAAGCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175028.1-3067s21c1
Sequence:CCGGGCAAGTCCAGCCCGGATTTATCTCGAGATAAATCCGGGCTGGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175028.1-3964s21c1
Sequence:CCGGGCATCGCTCCCTCCTAGTTTACTCGAGTAAACTAGGAGGGAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175028
VALIDATED
ADNP2 MISSION shRNA shRNA Plasmid DNA
ADNP homeobox 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175028.1-226s21c1
Sequence:CCGGGGAGCTGATGAAGGATCTTAACTCGAGTTAAGATCCTTCATCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175028.1-3880s21c1
Sequence:GTACCGGACAGCCTGCAATCTACAAATACTCGAGTATTTGTAGATTGCAGGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175028.1-3491s21c1
Sequence:CCGGTTTGGGAAGAGAAGGTATATTCTCGAGAATATACCTTCTCTTCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175028.1-813s21c1
Sequence:CCGGACGCCCTGATGTATCACATTTCTCGAGAAATGTGATACATCAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175028.1-586s21c1
Sequence:CCGGGATAAGCTTCACGTGTCTAAACTCGAGTTTAGACACGTGAAGCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175028.1-3067s21c1
Sequence:CCGGGCAAGTCCAGCCCGGATTTATCTCGAGATAAATCCGGGCTGGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175028.1-3964s21c1
Sequence:CCGGGCATCGCTCCCTCCTAGTTTACTCGAGTAAACTAGGAGGGAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175028
VALIDATED
ADNP2 MISSION shRNA Lentiviral Transduction Particles
ADNP homeobox 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175028.1-226s21c1
Sequence:CCGGGGAGCTGATGAAGGATCTTAACTCGAGTTAAGATCCTTCATCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175028.1-3880s21c1
Sequence:GTACCGGACAGCCTGCAATCTACAAATACTCGAGTATTTGTAGATTGCAGGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175028.1-3491s21c1
Sequence:CCGGTTTGGGAAGAGAAGGTATATTCTCGAGAATATACCTTCTCTTCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175028.1-813s21c1
Sequence:CCGGACGCCCTGATGTATCACATTTCTCGAGAAATGTGATACATCAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175028.1-586s21c1
Sequence:CCGGGATAAGCTTCACGTGTCTAAACTCGAGTTTAGACACGTGAAGCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175028.1-3067s21c1
Sequence:CCGGGCAAGTCCAGCCCGGATTTATCTCGAGATAAATCCGGGCTGGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175028.1-3964s21c1
Sequence:CCGGGCATCGCTCCCTCCTAGTTTACTCGAGTAAACTAGGAGGGAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014913
ADNP2 MISSION shRNA Bacterial Glycerol Stock
ADNP homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-2845s21c1
Sequence:CCGGAGAAGTTGCCTATGGATTATACTCGAGTATAATCCATAGGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-1138s21c1
Sequence:CCGGATGCGTTAATGTATCACATTTCTCGAGAAATGTGATACATTAACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-1539s21c1
Sequence:CCGGCCACTTCATCAGTCTGTGAATCTCGAGATTCACAGACTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014913.3-4006s21c1
Sequence:CCGGTACCAGGAAGCCAGTAGTTATCTCGAGATAACTACTGGCTTCCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-552s21c1
Sequence:CCGGGAGTTACTGAAGGACCTTAAACTCGAGTTTAAGGTCCTTCAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014913
ADNP2 MISSION shRNA shRNA Plasmid DNA
ADNP homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-2845s21c1
Sequence:CCGGAGAAGTTGCCTATGGATTATACTCGAGTATAATCCATAGGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-1138s21c1
Sequence:CCGGATGCGTTAATGTATCACATTTCTCGAGAAATGTGATACATTAACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-1539s21c1
Sequence:CCGGCCACTTCATCAGTCTGTGAATCTCGAGATTCACAGACTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014913.3-4006s21c1
Sequence:CCGGTACCAGGAAGCCAGTAGTTATCTCGAGATAACTACTGGCTTCCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-552s21c1
Sequence:CCGGGAGTTACTGAAGGACCTTAAACTCGAGTTTAAGGTCCTTCAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014913
ADNP2 MISSION shRNA Lentiviral Transduction Particles
ADNP homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-2845s21c1
Sequence:CCGGAGAAGTTGCCTATGGATTATACTCGAGTATAATCCATAGGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-1138s21c1
Sequence:CCGGATGCGTTAATGTATCACATTTCTCGAGAAATGTGATACATTAACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-1539s21c1
Sequence:CCGGCCACTTCATCAGTCTGTGAATCTCGAGATTCACAGACTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014913.3-4006s21c1
Sequence:CCGGTACCAGGAAGCCAGTAGTTATCTCGAGATAACTACTGGCTTCCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014913.3-552s21c1
Sequence:CCGGGAGTTACTGAAGGACCTTAAACTCGAGTTTAAGGTCCTTCAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks