EMAIL THIS PAGE TO A FRIEND

ADNP

activity-dependent neuroprotector homeobox

Synonyms: ADNP1
UniProtKB ID: Q9H2P0, E1P5Y2, O94881, Q5BKU2, Q9UG34
Gene ID:
Human(23394) Summary: Vasoactive intestinal peptide is a neuroprotective factor that has a stimulatory effect on the growth of some tumor cells and an inhibitory effect on others. This gene encodes a protein that is upregulated by vasoactive intestinal peptide and may be involved in its stimulatory effect on certain tumor cells. The encoded protein contains one homeobox and nine zinc finger domains, suggesting that it functions as a transcription factor. This gene is also upregulated in normal proliferative tissues. Finally, the encoded protein may increase the viability of certain cell types through modulation of p53 activity. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
Mouse(11538) activity-dependent neuroprotective protein
Rat(64622) activity-dependent neuroprotector homeobox
Zebrafish(100330315) activity-dependent neuroprotector homeobox
cow(533757) activity-dependent neuroprotector homeobox
Horse(100049902) activity-dependent neuroprotector homeobox
domestic cat(101099112) activity-dependent neuroprotector homeobox
dog(485927) activity-dependent neuroprotector homeobox
chicken(419350) activity-dependent neuroprotector homeobox
sheep(101122715) activity-dependent neuroprotector homeobox
Domestic Rabbit(100353072) activity-dependent neuroprotector homeobox
naked mole-rat(101723653) activity-dependent neuroprotector homeobox
domestic guinea pig(100730148) activity-dependent neuroprotector homeobox
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015339 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015339 Rosetta Predictions human pricing
NM_181442 Rosetta Predictions human pricing
NM_022681 Rosetta Predictions rat pricing
NM_009628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201777 predicted 2376
2 SASI_Hs01_00201778 predicted 1034
3 SASI_Hs01_00201779 predicted 2283
4 SASI_Hs01_00201781 predicted 2994
5 SASI_Hs01_00201782 predicted 2767
6 SASI_Hs02_00347644 predicted 1449
7 SASI_Hs01_00201783 predicted 2611
8 SASI_Hs01_00201784 predicted 1841
9 SASI_Hs01_00201786 predicted 1655
10 SASI_Hs02_00347645 predicted 1255
11 SASI_Hs01_00201780 predicted 2245
12 SASI_Hs01_00201785 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118716 predicted 2203
2 SASI_Hs01_00118717 predicted 860
3 SASI_Hs01_00118718 predicted 2110
4 SASI_Hs01_00118720 predicted 2823
5 SASI_Hs01_00118721 predicted 2585
6 SASI_Hs02_00370054 predicted 1275
7 SASI_Hs01_00118722 predicted 2435
8 SASI_Hs01_00118723 predicted 1668
9 SASI_Hs01_00118725 predicted 1474
10 SASI_Hs02_00370055 predicted 1076
11 SASI_Hs01_00118719 predicted 2073
12 SASI_Hs01_00118724 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038429 predicted 2409
2 SASI_Rn01_00038430 predicted 1385
3 SASI_Rn01_00038431 predicted 453
4 SASI_Rn01_00038432 predicted 1763
5 SASI_Rn01_00038434 predicted 2040
6 SASI_Rn01_00038435 predicted 2060
7 SASI_Rn01_00038436 predicted 862
8 SASI_Rn01_00038437 predicted 287
9 SASI_Rn01_00038438 predicted 892
10 SASI_Rn02_00263467 predicted 1069
11 SASI_Rn01_00038433 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089066 predicted 1731
2 SASI_Mm01_00089067 predicted 1343
3 SASI_Mm01_00089068 predicted 811
4 SASI_Mm01_00089069 predicted 2849
5 SASI_Mm01_00089070 predicted 565
6 SASI_Mm01_00089071 predicted 2385
7 SASI_Mm01_00089072 predicted 1185
8 SASI_Mm01_00089073 predicted 1857
9 SASI_Mm01_00089074 predicted 639
10 SASI_Mm02_00316581 predicted 1916
11 SASI_Mm01_00089065 predicted 1591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015339
ADNP MISSION shRNA Bacterial Glycerol Stock
activity-dependent neuroprotector homeobox
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015339.2-3792s21c1
Sequence:CCGGGTGGTTATTTCTAAGTCTATGCTCGAGCATAGACTTAGAAATAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015339.2-3612s21c1
Sequence:CCGGTGGCAGCTTAGCCGGAGTTAACTCGAGTTAACTCCGGCTAAGCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015339.2-3880s21c1
Sequence:CCGGTAAGCTGGTGACTCATGAATACTCGAGTATTCATGAGTCACCAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015339.2-1066s21c1
Sequence:CCGGATCGAAGACCATGAACGTATACTCGAGTATACGTTCATGGTCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015339.2-3498s21c1
Sequence:CCGGTGAGAATGATGAGCGCTTATCCTCGAGGATAAGCGCTCATCATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-988s1c1
Sequence:CCGGGCCCGAGAAGAGAGTAGTATTCTCGAGAATACTACTCTCTTCTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-3178s1c1
Sequence:CCGGCCAACCAAACTAATGCACAATCTCGAGATTGTGCATTAGTTTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-2494s1c1
Sequence:CCGGCGCACTTACGAGCAAATGGAACTCGAGTTCCATTTGCTCGTAAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-1102s1c1
Sequence:CCGGGCCATGATTGGGCACACAAATCTCGAGATTTGTGTGCCCAATCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-2374s1c1
Sequence:CCGGGCCTCAACTATCACTCTGCATCTCGAGATGCAGAGTGATAGTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015339
ADNP MISSION shRNA shRNA Plasmid DNA
activity-dependent neuroprotector homeobox
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015339.2-3792s21c1
Sequence:CCGGGTGGTTATTTCTAAGTCTATGCTCGAGCATAGACTTAGAAATAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015339.2-3612s21c1
Sequence:CCGGTGGCAGCTTAGCCGGAGTTAACTCGAGTTAACTCCGGCTAAGCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015339.2-3880s21c1
Sequence:CCGGTAAGCTGGTGACTCATGAATACTCGAGTATTCATGAGTCACCAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015339.2-1066s21c1
Sequence:CCGGATCGAAGACCATGAACGTATACTCGAGTATACGTTCATGGTCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015339.2-3498s21c1
Sequence:CCGGTGAGAATGATGAGCGCTTATCCTCGAGGATAAGCGCTCATCATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-988s1c1
Sequence:CCGGGCCCGAGAAGAGAGTAGTATTCTCGAGAATACTACTCTCTTCTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-3178s1c1
Sequence:CCGGCCAACCAAACTAATGCACAATCTCGAGATTGTGCATTAGTTTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-2494s1c1
Sequence:CCGGCGCACTTACGAGCAAATGGAACTCGAGTTCCATTTGCTCGTAAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-1102s1c1
Sequence:CCGGGCCATGATTGGGCACACAAATCTCGAGATTTGTGTGCCCAATCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-2374s1c1
Sequence:CCGGGCCTCAACTATCACTCTGCATCTCGAGATGCAGAGTGATAGTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015339
ADNP MISSION shRNA Lentiviral Transduction Particles
activity-dependent neuroprotector homeobox
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015339.2-3792s21c1
Sequence:CCGGGTGGTTATTTCTAAGTCTATGCTCGAGCATAGACTTAGAAATAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015339.2-3612s21c1
Sequence:CCGGTGGCAGCTTAGCCGGAGTTAACTCGAGTTAACTCCGGCTAAGCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015339.2-3880s21c1
Sequence:CCGGTAAGCTGGTGACTCATGAATACTCGAGTATTCATGAGTCACCAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015339.2-1066s21c1
Sequence:CCGGATCGAAGACCATGAACGTATACTCGAGTATACGTTCATGGTCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015339.2-3498s21c1
Sequence:CCGGTGAGAATGATGAGCGCTTATCCTCGAGGATAAGCGCTCATCATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-988s1c1
Sequence:CCGGGCCCGAGAAGAGAGTAGTATTCTCGAGAATACTACTCTCTTCTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-3178s1c1
Sequence:CCGGCCAACCAAACTAATGCACAATCTCGAGATTGTGCATTAGTTTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-2494s1c1
Sequence:CCGGCGCACTTACGAGCAAATGGAACTCGAGTTCCATTTGCTCGTAAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-1102s1c1
Sequence:CCGGGCCATGATTGGGCACACAAATCTCGAGATTTGTGTGCCCAATCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015339.2-2374s1c1
Sequence:CCGGGCCTCAACTATCACTCTGCATCTCGAGATGCAGAGTGATAGTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009628
VALIDATED
ADNP MISSION shRNA Bacterial Glycerol Stock
activity-dependent neuroprotector homeobox
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-2775s21c1
Sequence:CCGGGATTCTTATGAGGCTAGGAAACTCGAGTTTCCTAGCCTCATAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-1985s21c1
Sequence:CCGGGCCTACAGATACCCTACTCAACTCGAGTTGAGTAGGGTATCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-2319s21c1
Sequence:CCGGCAAGCTGCAGTGCCCTATAAACTCGAGTTTATAGGGCACTGCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-3968s21c1
Sequence:CCGGCTGTAGTCTCAGTGGTTATTTCTCGAGAAATAACCACTGAGACTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-1417s21c1
Sequence:CCGGCAATACCAAAGCCCAACTTAACTCGAGTTAAGTTGGGCTTTGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-651s1c1
Sequence:CCGGGCCTACAGATACCCTACTCAACTCGAGTTGAGTAGGGTATCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009628.1-1563s1c1
Sequence:CCGGCCATTTCAGTAACAAGAGGAACTCGAGTTCCTCTTGTTACTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-1441s1c1
Sequence:CCGGGATTCTTATGAGGCTAGGAAACTCGAGTTTCCTAGCCTCATAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-254s1c1
Sequence:CCGGCCGTGAAACAGTTACTTCCAACTCGAGTTGGAAGTAACTGTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-1873s1c1
Sequence:CCGGGATAATTTAGAGGAGCCTGTACTCGAGTACAGGCTCCTCTAAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009628
VALIDATED
ADNP MISSION shRNA shRNA Plasmid DNA
activity-dependent neuroprotector homeobox
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-2775s21c1
Sequence:CCGGGATTCTTATGAGGCTAGGAAACTCGAGTTTCCTAGCCTCATAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-1985s21c1
Sequence:CCGGGCCTACAGATACCCTACTCAACTCGAGTTGAGTAGGGTATCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-2319s21c1
Sequence:CCGGCAAGCTGCAGTGCCCTATAAACTCGAGTTTATAGGGCACTGCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-3968s21c1
Sequence:CCGGCTGTAGTCTCAGTGGTTATTTCTCGAGAAATAACCACTGAGACTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-1417s21c1
Sequence:CCGGCAATACCAAAGCCCAACTTAACTCGAGTTAAGTTGGGCTTTGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-651s1c1
Sequence:CCGGGCCTACAGATACCCTACTCAACTCGAGTTGAGTAGGGTATCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009628.1-1563s1c1
Sequence:CCGGCCATTTCAGTAACAAGAGGAACTCGAGTTCCTCTTGTTACTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-1441s1c1
Sequence:CCGGGATTCTTATGAGGCTAGGAAACTCGAGTTTCCTAGCCTCATAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-254s1c1
Sequence:CCGGCCGTGAAACAGTTACTTCCAACTCGAGTTGGAAGTAACTGTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-1873s1c1
Sequence:CCGGGATAATTTAGAGGAGCCTGTACTCGAGTACAGGCTCCTCTAAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009628
VALIDATED
ADNP MISSION shRNA Lentiviral Transduction Particles
activity-dependent neuroprotector homeobox
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-2775s21c1
Sequence:CCGGGATTCTTATGAGGCTAGGAAACTCGAGTTTCCTAGCCTCATAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-1985s21c1
Sequence:CCGGGCCTACAGATACCCTACTCAACTCGAGTTGAGTAGGGTATCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-2319s21c1
Sequence:CCGGCAAGCTGCAGTGCCCTATAAACTCGAGTTTATAGGGCACTGCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-3968s21c1
Sequence:CCGGCTGTAGTCTCAGTGGTTATTTCTCGAGAAATAACCACTGAGACTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009628.2-1417s21c1
Sequence:CCGGCAATACCAAAGCCCAACTTAACTCGAGTTAAGTTGGGCTTTGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-651s1c1
Sequence:CCGGGCCTACAGATACCCTACTCAACTCGAGTTGAGTAGGGTATCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009628.1-1563s1c1
Sequence:CCGGCCATTTCAGTAACAAGAGGAACTCGAGTTCCTCTTGTTACTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-1441s1c1
Sequence:CCGGGATTCTTATGAGGCTAGGAAACTCGAGTTTCCTAGCCTCATAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-254s1c1
Sequence:CCGGCCGTGAAACAGTTACTTCCAACTCGAGTTGGAAGTAACTGTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009628.1-1873s1c1
Sequence:CCGGGATAATTTAGAGGAGCCTGTACTCGAGTACAGGCTCCTCTAAATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks