EMAIL THIS PAGE TO A FRIEND

ADO

2-aminoethanethiol (cysteamine) dioxygenase

111 Gene Product Result for
Synonyms: C10orf22
UniProtKB ID: Q96SZ5, B1AL29
Gene ID:
Human(84890) Summary: Human thiol dioxygenases include cysteine dioxygenase (CDO; MIM 603943) and cysteamine (2-aminoethanethiol) dioxygenase (ADO; EC 1.13.11.19). CDO adds 2 oxygen atoms to free cysteine, whereas ADO adds 2 oxygen atoms to free cysteamine to form hypotaurine (Dominy et al., 2007 [PubMed 17581819]
Mouse(211488) 2-aminoethanethiol (cysteamine) dioxygenase
Rat(309732) 2-aminoethanethiol (cysteamine) dioxygenase
fruit fly(45988) adolescent
cow(100297937) 2-aminoethanethiol (cysteamine) dioxygenase
domestic cat(101082264) 2-aminoethanethiol (cysteamine) dioxygenase
dog(489003) 2-aminoethanethiol (cysteamine) dioxygenase
sheep(101121567) 2-aminoethanethiol (cysteamine) dioxygenase
naked mole-rat(101713027) 2-aminoethanethiol (cysteamine) dioxygenase
domestic guinea pig(101787186) 2-aminoethanethiol (cysteamine) dioxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032804 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032804 Rosetta Predictions human pricing
NM_001107626 Rosetta Predictions rat pricing
NM_001005419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081027 predicted 1615
2 SASI_Hs02_00360366 predicted 1380
3 SASI_Hs01_00081028 predicted 868
4 SASI_Hs01_00081029 predicted 1374
5 SASI_Hs01_00081031 predicted 1059
6 SASI_Hs02_00360367 predicted 641
7 SASI_Hs01_00081032 predicted 1008
8 SASI_Hs01_00081034 predicted 1160
9 SASI_Hs02_00360368 predicted 1144
10 SASI_Hs01_00081035 predicted 1541
11 SASI_Hs01_00081030 predicted 1472
12 SASI_Hs01_00081033 predicted 560
13 SASI_Hs01_00081036 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230685 predicted 907
2 SASI_Rn02_00230686 predicted 1228
3 SASI_Rn02_00230687 predicted 1261
4 SASI_Rn02_00230688 predicted 642
5 SASI_Rn02_00230689 predicted 1015
6 SASI_Rn02_00230690 predicted 690
7 SASI_Rn02_00230691 predicted 1014
8 SASI_Rn02_00230692 predicted 728
9 SASI_Rn02_00230693 predicted 1224
10 SASI_Rn02_00230694 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041737 predicted 1189
2 SASI_Mm01_00041739 predicted 1177
3 SASI_Mm01_00041740 predicted 1067
4 SASI_Mm01_00041741 predicted 789
5 SASI_Mm02_00286575 predicted 413
6 SASI_Mm02_00286576 predicted 1188
7 SASI_Mm01_00041743 predicted 922
8 SASI_Mm01_00041744 predicted 1043
9 SASI_Mm01_00041745 predicted 444
10 SASI_Mm02_00286577 predicted 880
11 SASI_Mm01_00041736 predicted 689
12 SASI_Mm01_00041738 predicted 280
13 SASI_Mm01_00041742 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005419
VALIDATED
ADO MISSION shRNA Bacterial Glycerol Stock
2-aminoethanethiol (cysteamine) dioxygenase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-487s21c1
Sequence:CCGGCGGTATGCTCAAGGTGCTGTACTCGAGTACAGCACCTTGAGCATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-385s21c1
Sequence:CCGGGGTCACCTACATGCACATCTACTCGAGTAGATGTGCATGTAGGTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-1044s21c1
Sequence:CCGGCTCGCCTGGACGATGGATTTACTCGAGTAAATCCATCGTCCAGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005419.1-784s21c1
Sequence:CCGGCTGCCACTATTACCGTGTAGTCTCGAGACTACACGGTAATAGTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-696s21c1
Sequence:CCGGACAACCTGCACCAGATTGATGCTCGAGCATCAATCTGGTGCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005419.1-3310s1c1
Sequence:CCGGGCCTGGAATTGGGCTAGTAATCTCGAGATTACTAGCCCAATTCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005419.1-1774s1c1
Sequence:CCGGCGTGCTTCAAAGATGATACAACTCGAGTTGTATCATCTTTGAAGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005419
VALIDATED
ADO MISSION shRNA shRNA Plasmid DNA
2-aminoethanethiol (cysteamine) dioxygenase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-487s21c1
Sequence:CCGGCGGTATGCTCAAGGTGCTGTACTCGAGTACAGCACCTTGAGCATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-385s21c1
Sequence:CCGGGGTCACCTACATGCACATCTACTCGAGTAGATGTGCATGTAGGTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-1044s21c1
Sequence:CCGGCTCGCCTGGACGATGGATTTACTCGAGTAAATCCATCGTCCAGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005419.1-784s21c1
Sequence:CCGGCTGCCACTATTACCGTGTAGTCTCGAGACTACACGGTAATAGTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-696s21c1
Sequence:CCGGACAACCTGCACCAGATTGATGCTCGAGCATCAATCTGGTGCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005419.1-3310s1c1
Sequence:CCGGGCCTGGAATTGGGCTAGTAATCTCGAGATTACTAGCCCAATTCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005419.1-1774s1c1
Sequence:CCGGCGTGCTTCAAAGATGATACAACTCGAGTTGTATCATCTTTGAAGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005419
VALIDATED
ADO MISSION shRNA Lentiviral Transduction Particles
2-aminoethanethiol (cysteamine) dioxygenase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-487s21c1
Sequence:CCGGCGGTATGCTCAAGGTGCTGTACTCGAGTACAGCACCTTGAGCATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-385s21c1
Sequence:CCGGGGTCACCTACATGCACATCTACTCGAGTAGATGTGCATGTAGGTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-1044s21c1
Sequence:CCGGCTCGCCTGGACGATGGATTTACTCGAGTAAATCCATCGTCCAGGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005419.1-784s21c1
Sequence:CCGGCTGCCACTATTACCGTGTAGTCTCGAGACTACACGGTAATAGTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005419.1-696s21c1
Sequence:CCGGACAACCTGCACCAGATTGATGCTCGAGCATCAATCTGGTGCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005419.1-3310s1c1
Sequence:CCGGGCCTGGAATTGGGCTAGTAATCTCGAGATTACTAGCCCAATTCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005419.1-1774s1c1
Sequence:CCGGCGTGCTTCAAAGATGATACAACTCGAGTTGTATCATCTTTGAAGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032804
ADO MISSION shRNA Bacterial Glycerol Stock
2-aminoethanethiol (cysteamine) dioxygenase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-1090s21c1
Sequence:CCGGCTATCCAGGTCCCAAGGTCTTCTCGAGAAGACCTTGGGACCTGGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032804.5-1633s21c1
Sequence:CCGGGTGAGCTGGCCTGCCTAATTACTCGAGTAATTAGGCAGGCCAGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-557s21c1
Sequence:CCGGGTCACCTACATGCACATCTACCTCGAGGTAGATGTGCATGTAGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-597s21c1
Sequence:CCGGTGGGCGTGTTCCTGCTCAAGACTCGAGTCTTGAGCAGGAACACGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-695s21c1
Sequence:CCGGAGCTGCATGGACAAGCTAGACCTCGAGGTCTAGCTTGTCCATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2841s1c1
Sequence:CCGGCCACAGGACATGCCACTTTATCTCGAGATAAAGTGGCATGTCCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2052s1c1
Sequence:CCGGGCCAGTTGTTGCATTCCCTATCTCGAGATAGGGAATGCAACAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2887s1c1
Sequence:CCGGCCAAGTATTTCCTGCATTGTTCTCGAGAACAATGCAGGAAATACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161536    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2020s1c1
Sequence:CCGGGCTTCCAAACAACTGAATGTACTCGAGTACATTCAGTTGTTTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161278    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-3076s1c1
Sequence:CCGGGCACAGTAATGAATGTGGTTACTCGAGTAACCACATTCATTACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161918    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-1874s1c1
Sequence:CCGGGCAGATTTCATGTTGCAGATTCTCGAGAATCTGCAACATGAAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163181    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-1385s1c1
Sequence:CCGGGCTTCCATCCTAAAGCCATAACTCGAGTTATGGCTTTAGGATGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2432s1c1
Sequence:CCGGCGAGCAGTCTTACCTTGTTTACTCGAGTAAACAAGGTAAGACTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032804
ADO MISSION shRNA shRNA Plasmid DNA
2-aminoethanethiol (cysteamine) dioxygenase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-1090s21c1
Sequence:CCGGCTATCCAGGTCCCAAGGTCTTCTCGAGAAGACCTTGGGACCTGGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032804.5-1633s21c1
Sequence:CCGGGTGAGCTGGCCTGCCTAATTACTCGAGTAATTAGGCAGGCCAGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-557s21c1
Sequence:CCGGGTCACCTACATGCACATCTACCTCGAGGTAGATGTGCATGTAGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-597s21c1
Sequence:CCGGTGGGCGTGTTCCTGCTCAAGACTCGAGTCTTGAGCAGGAACACGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-695s21c1
Sequence:CCGGAGCTGCATGGACAAGCTAGACCTCGAGGTCTAGCTTGTCCATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2841s1c1
Sequence:CCGGCCACAGGACATGCCACTTTATCTCGAGATAAAGTGGCATGTCCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2052s1c1
Sequence:CCGGGCCAGTTGTTGCATTCCCTATCTCGAGATAGGGAATGCAACAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2887s1c1
Sequence:CCGGCCAAGTATTTCCTGCATTGTTCTCGAGAACAATGCAGGAAATACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161536    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2020s1c1
Sequence:CCGGGCTTCCAAACAACTGAATGTACTCGAGTACATTCAGTTGTTTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161278    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-3076s1c1
Sequence:CCGGGCACAGTAATGAATGTGGTTACTCGAGTAACCACATTCATTACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161918    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-1874s1c1
Sequence:CCGGGCAGATTTCATGTTGCAGATTCTCGAGAATCTGCAACATGAAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163181    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-1385s1c1
Sequence:CCGGGCTTCCATCCTAAAGCCATAACTCGAGTTATGGCTTTAGGATGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2432s1c1
Sequence:CCGGCGAGCAGTCTTACCTTGTTTACTCGAGTAAACAAGGTAAGACTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032804
ADO MISSION shRNA Lentiviral Transduction Particles
2-aminoethanethiol (cysteamine) dioxygenase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-1090s21c1
Sequence:CCGGCTATCCAGGTCCCAAGGTCTTCTCGAGAAGACCTTGGGACCTGGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032804.5-1633s21c1
Sequence:CCGGGTGAGCTGGCCTGCCTAATTACTCGAGTAATTAGGCAGGCCAGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-557s21c1
Sequence:CCGGGTCACCTACATGCACATCTACCTCGAGGTAGATGTGCATGTAGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-597s21c1
Sequence:CCGGTGGGCGTGTTCCTGCTCAAGACTCGAGTCTTGAGCAGGAACACGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032804.5-695s21c1
Sequence:CCGGAGCTGCATGGACAAGCTAGACCTCGAGGTCTAGCTTGTCCATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2841s1c1
Sequence:CCGGCCACAGGACATGCCACTTTATCTCGAGATAAAGTGGCATGTCCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2052s1c1
Sequence:CCGGGCCAGTTGTTGCATTCCCTATCTCGAGATAGGGAATGCAACAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2887s1c1
Sequence:CCGGCCAAGTATTTCCTGCATTGTTCTCGAGAACAATGCAGGAAATACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161536    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2020s1c1
Sequence:CCGGGCTTCCAAACAACTGAATGTACTCGAGTACATTCAGTTGTTTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161278    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-3076s1c1
Sequence:CCGGGCACAGTAATGAATGTGGTTACTCGAGTAACCACATTCATTACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161918    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-1874s1c1
Sequence:CCGGGCAGATTTCATGTTGCAGATTCTCGAGAATCTGCAACATGAAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163181    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-1385s1c1
Sequence:CCGGGCTTCCATCCTAAAGCCATAACTCGAGTTATGGCTTTAGGATGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032804.5-2432s1c1
Sequence:CCGGCGAGCAGTCTTACCTTGTTTACTCGAGTAAACAAGGTAAGACTGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)