EMAIL THIS PAGE TO A FRIEND

ADORA1

adenosine A1 receptor

178 Gene Product Result for
Synonyms: RDC7
Gene ID:
Human(134) Summary: The protein encoded by this gene is an adenosine receptor that belongs to the G-protein coupled receptor 1 family. There are 3 types of adenosine receptors, each with a specific pattern of ligand binding and tissue distribution, and together they regulate a diverse set of physiologic functions. The type A1 receptors inhibit adenylyl cyclase, and play a role in the fertilization process. Animal studies also suggest a role for A1 receptors in kidney function and ethanol intoxication. Transcript variants with alternative splicing in the 5' UTR have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11539) adenosine A1 receptor
Rat(29290) adenosine A1 receptor
Zebrafish(100150997) adenosine A1 receptor
dog(403961) adenosine A1 receptor
domestic cat(101100536) adenosine A1 receptor
chicken(374212) adenosine A1 receptor
cow(282133) adenosine A1 receptor
domestic guinea pig(100135472) adenosine A1 receptor
naked mole-rat(101704638) adenosine A1 receptor
sheep(101109816) adenosine A1 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
P4532 (−)-N6-(2-Phenylisopropyl)adenosine solid human pricing
E111 (S)-ENBA human pricing
P107 N6-(2-Phenylethyl)adenosine human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C102 8-Cyclopentyl-1,3-dimethylxanthine ≥98% (HPLC), powder human pricing
A28651 Alloxazine 96% human pricing
C239 CNQX disodium salt hydrate ≥98% (HPLC), solid human pricing
159182 Ethyl 2-amino-4,5,6,7-tetrahydrobenzo[b]thiophene-3-carboxylate 97% human pricing
P9689 Propentofylline solid human pricing
T7450 T62 ≥98% (HPLC), crystalline human pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
D5011 5′-Deoxy-5′-(methylthio)adenosine human, mouse, rat pricing
C197 8-(3-Chlorostyryl)caffeine ≥98% (HPLC), solid human, mouse, rat pricing
A3145 Apigenin ≥97% (TLC), from parsley, powder human, mouse, rat pricing
10798 Apigenin ≥95.0% (HPLC) human, mouse, rat pricing
SMB00702 Apigenin ≥97% (TLC), from citrus New human, mouse, rat pricing
27602 Caffeine anhydrous, tested according to Ph.Eur. human, mouse, rat pricing
C0750 Caffeine powder, ReagentPlus® human, mouse, rat pricing
C8960 Caffeine BioXtra human, mouse, rat pricing
C1778 Caffeine Sigma Reference Standard, vial of 250 mg human, mouse, rat pricing
C7731 Caffeine meets USP testing specifications, anhydrous human, mouse, rat pricing
W222402 Caffeine anhydrous, 99%, FCC, FG human, mouse, rat pricing
C6035 Caffeine solution analytical standard, 1.0 mg/mL in methanol human, mouse, rat pricing
C1530 Cyclopiazonic acid from Penicillium cyclopium ≥98% (HPLC), powder human, mouse, rat pricing
102032 Flavanone 98% human, mouse, rat pricing
F2003 Flavone human, mouse, rat pricing
G6649 Genistein synthetic, ≥98% (HPLC), powder human, mouse, rat pricing
G6776 Genistein from Glycine max (soybean), ~98% (HPLC) human, mouse, rat pricing
75035 Mettler-Toledo Calibration substance ME 18872, Caffeine analytical standard, for the calibration of the thermosystem 900, traceable to primary standards (LGC) human, mouse, rat pricing
C8031 N6-Cyclopentyladenosine solid human, mouse, rat pricing
N7634 Nifedipine ≥98% (HPLC), powder human, mouse, rat pricing
R6520 Rolipram solid, ≥98% (HPLC) human, mouse, rat pricing
T1633 Theophylline anhydrous, ≥99%, powder human, mouse, rat pricing
B133 (S)-(−)-Bay K8644 ≥98% (HPLC), solid human, rat pricing
P2278 1,3-Dimethyl-8-phenylxanthine crystalline human, rat pricing
D108 1,3-Dipropyl-7-methylxanthine solid human, rat pricing
A022 1,3-Dipropyl-8-(p-sulfophenyl)xanthine powder human, rat pricing
D5385 1,7-Dimethylxanthine ~98%, solid human, rat pricing
A145 1-Allyl-3,7-dimethyl-8-sulfophenylxanthine solid human, rat pricing
C4438 2-Chloro-2′-deoxyadenosine antileukemic human, rat pricing
C7938 2-Chloro-N6-cyclopentyladenosine adenosine receptor agonist human, rat pricing
C5134 2-Chloroadenosine human, rat pricing
F2773 2-Fluoroadenine-9-β-D-arabinofuranoside DNA synthesis and methylation inhibitor human, rat pricing
656402 2-Fluoroadenosine 97% human, rat pricing
663115 2-Iodoadenosine 97% human, rat pricing
P101 2-Phenylaminoadenosine >97%, solid human, rat pricing
D134 3,7-Dimethyl-1-propargylxanthine ≥98% (HPLC), powder human, rat pricing
I5879 3-Isobutyl-1-methylxanthine ≥99% (HPLC), powder human, rat pricing
E2387 5′-(N-Ethylcarboxamido)adenosine powder human, rat pricing
A013 8-(p-Sulfophenyl)theophylline hydrate solid human, rat pricing
C101 8-Cyclopentyl-1,3-dipropylxanthine solid human, rat pricing
N5757 α-Naphthoflavone human, rat pricing
A236 AB-MECA solid human, rat pricing
A9251 Adenosine ≥99% human, rat pricing
A4036 Adenosine suitable for cell culture, BioReagent human, rat pricing
C199 CGS-15943 solid human, rat pricing
C277 Chloro-IB-MECA solid, ≥98% (HPLC) human, rat pricing
282200 Galangin autophagy inducing flavonoid human, rat pricing
I145 I-AB-MECA solid human, rat pricing
I146 IB-MECA solid, ≥98% (HPLC) human, rat pricing
M228 MRS 1220 solid human, rat pricing
M1809 MRS 1523 >98% (HPLC) human, rat pricing
M6316 MRS 1754 hydrate ≥98% (HPLC), solid human, rat pricing
A202 N6-2-(4-Aminophenyl)ethyladenosine >95% human, rat pricing
13155 N6-Benzyladenosine ≥99.0% human, rat pricing
C9901 N6-Cyclohexyladenosine human, rat pricing
N149 Nimodipine human, rat pricing
N144 Nitrendipine >95%, powder human, rat pricing
R3904 Reversine ≥98% (HPLC), solid human, rat pricing
S153 SQ 22,536 ≥97% (HPLC), powder human, rat pricing
T4500 Theobromine ≥98.0% human, rat pricing
X103 Xanthine amine congener ≥96% (HPLC) human, rat pricing
69720 1-Methylxanthine ≥97.0% (HPLC) rat pricing
41763 3,9-Dimethylxanthine ≥99.0% rat pricing
D8296 3-Deazaadenosine rat pricing
I7018 3-Isobutyl-1-methylxanthine BioUltra, ≥99% rat pricing
222526 3-Methylxanthine 98% rat pricing
69723 7-Methylxanthine ≥98.0% (HPLC) rat pricing
547328 9-Methyladenine 97% rat pricing
69725 9-Methylxanthine ≥98.0% rat pricing
A111 Adenosine amine congener hydrate solid, ≥98% (HPLC) rat pricing
C3394 Cordycepin from Cordyceps militaris rat pricing
H9627 Hematoxylin rat pricing
H3136 Hematoxylin certified by the Biological Stain Commission rat pricing
51260 Hematoxylin for microscopy (Hist.), indicator (pH 5.0-6.0) rat pricing
K3000 Kinetin riboside proapoptotic anitproliferative plant growth regulator rat pricing
T0642 Tubercidin from Streptomyces tubercidicus, ~95% rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
27600 Caffeine purum, anhydrous, ≥99.0% (HPLC) human pricing
05-0370 Caffeine SAJ special grade, ≥98.5% human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
G154 Gabapentin solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000674 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009629 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009629 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009629 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000674 Rosetta Predictions human pricing
NM_001048230 Rosetta Predictions human pricing
NM_017155 Rosetta Predictions rat pricing
NM_001008533 Rosetta Predictions mouse pricing
NM_001039510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100571 predicted 848
2 SASI_Hs01_00100572 predicted 1373
3 SASI_Hs01_00100574 predicted 1806
4 SASI_Hs01_00100575 predicted 1092
5 SASI_Hs01_00100576 predicted 1642
6 SASI_Hs01_00100578 predicted 756
7 SASI_Hs01_00100579 predicted 728
8 SASI_Hs01_00100580 predicted 649
9 SASI_Hs02_00303050 predicted 1902
10 SASI_Hs02_00303051 predicted 1856
11 SASI_Hs01_00100573 predicted 497
12 SASI_Hs01_00100577 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311792 predicted 696
2 SASI_Hs02_00311793 predicted 1218
3 SASI_Hs02_00311794 predicted 1650
4 SASI_Hs02_00311795 predicted 933
5 SASI_Hs02_00311796 predicted 1484
6 SASI_Hs02_00311797 predicted 594
7 SASI_Hs02_00311798 predicted 567
8 SASI_Hs02_00311799 predicted 489
9 SASI_Hs02_00311800 predicted 1752
10 SASI_Hs02_00311801 predicted 1703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261448 predicted 674
2 SASI_Rn02_00261449 predicted 437
3 SASI_Rn02_00261450 predicted 588
4 SASI_Rn02_00261451 predicted 637
5 SASI_Rn02_00261452 predicted 456
6 SASI_Rn02_00261453 predicted 855
7 SASI_Rn01_00058413 predicted 560
8 SASI_Rn02_00261454 predicted 846
9 SASI_Rn02_00261455 predicted 512
10 SASI_Rn02_00261456 predicted 277
11 SASI_Rn01_00058408 predicted 1829
12 SASI_Rn01_00058409 predicted 1802
13 SASI_Rn01_00058410 predicted 1299
14 SASI_Rn01_00058411 predicted 1877
15 SASI_Rn01_00058412 predicted 1786
16 SASI_Rn01_00058414 predicted 1027
17 SASI_Rn01_00058415 predicted 741
18 SASI_Rn01_00058416 predicted 850
19 SASI_Rn01_00058417 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121902 predicted 2451
2 SASI_Mm01_00121904 predicted 2004
3 SASI_Mm01_00121905 predicted 1946
4 SASI_Mm01_00121906 predicted 1640
5 SASI_Mm02_00286809 predicted 2464
6 SASI_Mm01_00121907 predicted 2305
7 SASI_Mm01_00121908 predicted 1512
8 SASI_Mm01_00121909 predicted 1459
9 SASI_Mm01_00121910 predicted 1391
10 SASI_Mm01_00121911 predicted 1369
11 SASI_Mm01_00121903 predicted 2516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023247 predicted 1640
2 SASI_Mm01_00023249 predicted 1200
3 SASI_Mm01_00023250 predicted 1135
4 SASI_Mm01_00023251 predicted 827
5 SASI_Mm02_00290096 predicted 1648
6 SASI_Mm01_00023252 predicted 1500
7 SASI_Mm01_00023253 predicted 693
8 SASI_Mm01_00023254 predicted 648
9 SASI_Mm01_00023255 predicted 577
10 SASI_Mm01_00023256 predicted 555
11 SASI_Mm01_00023248 predicted 1705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000674
ADORA1 MISSION shRNA Bacterial Glycerol Stock
adenosine A1 receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000674.1-2509s1c1
Sequence:CCGGCCCTAGTATCTGGCTGGGTTTCTCGAGAAACCCAGCCAGATACTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-938s1c1
Sequence:CCGGCATGGAGTACATGGTCTACTTCTCGAGAAGTAGACCATGTACTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-1296s1c1
Sequence:CCGGCGCGTCACCTTCCTTAAGATTCTCGAGAATCTTAAGGAAGGTGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-1214s1c1
Sequence:CCGGCCTTACCTACATTGCCATCTTCTCGAGAAGATGGCAATGTAGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-1206s1c1
Sequence:CCGGCCCAGCATCCTTACCTACATTCTCGAGAATGTAGGTAAGGATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000674.2-760s21c1
Sequence:CCGGCAAGATCCCTCTCCGGTACAACTCGAGTTGTACCGGAGAGGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000674.2-1230s21c1
Sequence:CCGGCCAGCATCCTTACCTACATTGCTCGAGCAATGTAGGTAAGGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000674.2-1320s21c1
Sequence:CCGGGCGTCACCTTCCTTAAGATTTCTCGAGAAATCTTAAGGAAGGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000674.2-1567s21c1
Sequence:CCGGGTCCCTCCACTAGGAGTTAACCTCGAGGTTAACTCCTAGTGGAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000674
ADORA1 MISSION shRNA shRNA Plasmid DNA
adenosine A1 receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000674.1-2509s1c1
Sequence:CCGGCCCTAGTATCTGGCTGGGTTTCTCGAGAAACCCAGCCAGATACTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-938s1c1
Sequence:CCGGCATGGAGTACATGGTCTACTTCTCGAGAAGTAGACCATGTACTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-1296s1c1
Sequence:CCGGCGCGTCACCTTCCTTAAGATTCTCGAGAATCTTAAGGAAGGTGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-1214s1c1
Sequence:CCGGCCTTACCTACATTGCCATCTTCTCGAGAAGATGGCAATGTAGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-1206s1c1
Sequence:CCGGCCCAGCATCCTTACCTACATTCTCGAGAATGTAGGTAAGGATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000674.2-760s21c1
Sequence:CCGGCAAGATCCCTCTCCGGTACAACTCGAGTTGTACCGGAGAGGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000674.2-1230s21c1
Sequence:CCGGCCAGCATCCTTACCTACATTGCTCGAGCAATGTAGGTAAGGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000674.2-1320s21c1
Sequence:CCGGGCGTCACCTTCCTTAAGATTTCTCGAGAAATCTTAAGGAAGGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000674.2-1567s21c1
Sequence:CCGGGTCCCTCCACTAGGAGTTAACCTCGAGGTTAACTCCTAGTGGAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000674
ADORA1 MISSION shRNA Lentiviral Transduction Particles
adenosine A1 receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000674.1-2509s1c1
Sequence:CCGGCCCTAGTATCTGGCTGGGTTTCTCGAGAAACCCAGCCAGATACTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-938s1c1
Sequence:CCGGCATGGAGTACATGGTCTACTTCTCGAGAAGTAGACCATGTACTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-1296s1c1
Sequence:CCGGCGCGTCACCTTCCTTAAGATTCTCGAGAATCTTAAGGAAGGTGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-1214s1c1
Sequence:CCGGCCTTACCTACATTGCCATCTTCTCGAGAAGATGGCAATGTAGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000674.1-1206s1c1
Sequence:CCGGCCCAGCATCCTTACCTACATTCTCGAGAATGTAGGTAAGGATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000674.2-760s21c1
Sequence:CCGGCAAGATCCCTCTCCGGTACAACTCGAGTTGTACCGGAGAGGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000674.2-1230s21c1
Sequence:CCGGCCAGCATCCTTACCTACATTGCTCGAGCAATGTAGGTAAGGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000674.2-1320s21c1
Sequence:CCGGGCGTCACCTTCCTTAAGATTTCTCGAGAAATCTTAAGGAAGGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000674.2-1567s21c1
Sequence:CCGGGTCCCTCCACTAGGAGTTAACCTCGAGGTTAACTCCTAGTGGAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009629
ADORA1 MISSION shRNA Bacterial Glycerol Stock
adenosine A1 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1559s1c1
Sequence:CCGGGAAGGTTATCAGCATGGAGTACTCGAGTACTCCATGCTGATAACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1617s1c1
Sequence:CCGGCCATTGCTCCTCATGGTTCTTCTCGAGAAGAACCATGAGGAGCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1790s1c1
Sequence:CCGGGCTACACATCTTGAACTGCATCTCGAGATGCAGTTCAAGATGTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1116s1c1
Sequence:CCGGCCCGGAAATGTACTGGTGATTCTCGAGAATCACCAGTACATTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1847s1c1
Sequence:CCGGCCTCATCTACATTGCCATCTTCTCGAGAAGATGGCAATGTAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009629
ADORA1 MISSION shRNA shRNA Plasmid DNA
adenosine A1 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1559s1c1
Sequence:CCGGGAAGGTTATCAGCATGGAGTACTCGAGTACTCCATGCTGATAACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1617s1c1
Sequence:CCGGCCATTGCTCCTCATGGTTCTTCTCGAGAAGAACCATGAGGAGCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1790s1c1
Sequence:CCGGGCTACACATCTTGAACTGCATCTCGAGATGCAGTTCAAGATGTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1116s1c1
Sequence:CCGGCCCGGAAATGTACTGGTGATTCTCGAGAATCACCAGTACATTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1847s1c1
Sequence:CCGGCCTCATCTACATTGCCATCTTCTCGAGAAGATGGCAATGTAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009629
ADORA1 MISSION shRNA Lentiviral Transduction Particles
adenosine A1 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1559s1c1
Sequence:CCGGGAAGGTTATCAGCATGGAGTACTCGAGTACTCCATGCTGATAACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1617s1c1
Sequence:CCGGCCATTGCTCCTCATGGTTCTTCTCGAGAAGAACCATGAGGAGCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1790s1c1
Sequence:CCGGGCTACACATCTTGAACTGCATCTCGAGATGCAGTTCAAGATGTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1116s1c1
Sequence:CCGGCCCGGAAATGTACTGGTGATTCTCGAGAATCACCAGTACATTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009629.1-1847s1c1
Sequence:CCGGCCTCATCTACATTGCCATCTTCTCGAGAAGATGGCAATGTAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks