EMAIL THIS PAGE TO A FRIEND

ADORA2A

adenosine A2a receptor

148 Gene Product Result for
Synonyms: A2aR ADORA2 RDC8
UniProtKB ID: P29274, B2R7E0
Gene ID:
Human(135) Summary: This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
Mouse(11540) adenosine A2a receptor
Rat(25369) adenosine A2a receptor
sheep(101112926) adenosine A2a receptor
naked mole-rat(101718082) adenosine A2a receptor
domestic guinea pig(100135473) adenosine A2a receptor
chicken(427705) adenosine A2a receptor
dog(403960) adenosine A2a receptor
cow(617828) adenosine A2a receptor
Horse(100034039) adenosine A2a receptor
domestic cat(101080742) adenosine A2a receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
C141 CGS-21680 hydrochloride hydrate solid human pricing
H8034 HE-NECA solid, ≥98% (HPLC) human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A28651 Alloxazine 96% human pricing
C239 CNQX disodium salt hydrate ≥98% (HPLC), solid human pricing
T2879 Tyramine hydrochloride ≥98% human pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
D5011 5′-Deoxy-5′-(methylthio)adenosine human, mouse, rat pricing
C197 8-(3-Chlorostyryl)caffeine ≥98% (HPLC), solid human, mouse, rat pricing
A3145 Apigenin ≥97% (TLC), from parsley, powder human, mouse, rat pricing
10798 Apigenin ≥95.0% (HPLC) human, mouse, rat pricing
SMB00702 Apigenin ≥97% (TLC), from citrus New human, mouse, rat pricing
27602 Caffeine anhydrous, tested according to Ph.Eur. human, mouse, rat pricing
C0750 Caffeine powder, ReagentPlus® human, mouse, rat pricing
C8960 Caffeine BioXtra human, mouse, rat pricing
C1778 Caffeine Sigma Reference Standard, vial of 250 mg human, mouse, rat pricing
C7731 Caffeine meets USP testing specifications, anhydrous human, mouse, rat pricing
W222402 Caffeine anhydrous, 99%, FCC, FG human, mouse, rat pricing
C6035 Caffeine solution analytical standard, 1.0 mg/mL in methanol human, mouse, rat pricing
C1530 Cyclopiazonic acid from Penicillium cyclopium ≥98% (HPLC), powder human, mouse, rat pricing
F2003 Flavone human, mouse, rat pricing
G6649 Genistein synthetic, ≥98% (HPLC), powder human, mouse, rat pricing
G6776 Genistein from Glycine max (soybean), ~98% (HPLC) human, mouse, rat pricing
75035 Mettler-Toledo Calibration substance ME 18872, Caffeine analytical standard, for the calibration of the thermosystem 900, traceable to primary standards (LGC) human, mouse, rat pricing
C8031 N6-Cyclopentyladenosine solid human, mouse, rat pricing
N7634 Nifedipine ≥98% (HPLC), powder human, mouse, rat pricing
T1633 Theophylline anhydrous, ≥99%, powder human, mouse, rat pricing
B133 (S)-(−)-Bay K8644 ≥98% (HPLC), solid human, rat pricing
P2278 1,3-Dimethyl-8-phenylxanthine crystalline human, rat pricing
D108 1,3-Dipropyl-7-methylxanthine solid human, rat pricing
A022 1,3-Dipropyl-8-(p-sulfophenyl)xanthine powder human, rat pricing
D5385 1,7-Dimethylxanthine ~98%, solid human, rat pricing
A145 1-Allyl-3,7-dimethyl-8-sulfophenylxanthine solid human, rat pricing
C4438 2-Chloro-2′-deoxyadenosine antileukemic human, rat pricing
C7938 2-Chloro-N6-cyclopentyladenosine adenosine receptor agonist human, rat pricing
F2773 2-Fluoroadenine-9-β-D-arabinofuranoside DNA synthesis and methylation inhibitor human, rat pricing
656402 2-Fluoroadenosine 97% human, rat pricing
663115 2-Iodoadenosine 97% human, rat pricing
P101 2-Phenylaminoadenosine >97%, solid human, rat pricing
D134 3,7-Dimethyl-1-propargylxanthine ≥98% (HPLC), powder human, rat pricing
I5879 3-Isobutyl-1-methylxanthine ≥99% (HPLC), powder human, rat pricing
E2387 5′-(N-Ethylcarboxamido)adenosine powder human, rat pricing
A013 8-(p-Sulfophenyl)theophylline hydrate solid human, rat pricing
C101 8-Cyclopentyl-1,3-dipropylxanthine solid human, rat pricing
N5757 α-Naphthoflavone human, rat pricing
A236 AB-MECA solid human, rat pricing
A4036 Adenosine suitable for cell culture, BioReagent human, rat pricing
C199 CGS-15943 solid human, rat pricing
C277 Chloro-IB-MECA solid, ≥98% (HPLC) human, rat pricing
282200 Galangin autophagy inducing flavonoid human, rat pricing
I145 I-AB-MECA solid human, rat pricing
I146 IB-MECA solid, ≥98% (HPLC) human, rat pricing
M228 MRS 1220 solid human, rat pricing
M1809 MRS 1523 >98% (HPLC) human, rat pricing
M6316 MRS 1754 hydrate ≥98% (HPLC), solid human, rat pricing
A202 N6-2-(4-Aminophenyl)ethyladenosine >95% human, rat pricing
13155 N6-Benzyladenosine ≥99.0% human, rat pricing
C9901 N6-Cyclohexyladenosine human, rat pricing
N149 Nimodipine human, rat pricing
N144 Nitrendipine >95%, powder human, rat pricing
R3904 Reversine ≥98% (HPLC), solid human, rat pricing
S153 SQ 22,536 ≥97% (HPLC), powder human, rat pricing
T4500 Theobromine ≥98.0% human, rat pricing
X103 Xanthine amine congener ≥96% (HPLC) human, rat pricing
69720 1-Methylxanthine ≥97.0% (HPLC) rat pricing
41763 3,9-Dimethylxanthine ≥99.0% rat pricing
D8296 3-Deazaadenosine rat pricing
I7018 3-Isobutyl-1-methylxanthine BioUltra, ≥99% rat pricing
222526 3-Methylxanthine 98% rat pricing
69723 7-Methylxanthine ≥98.0% (HPLC) rat pricing
B6272 8-Bromoadenosine powder rat pricing
547328 9-Methyladenine 97% rat pricing
69725 9-Methylxanthine ≥98.0% rat pricing
H9627 Hematoxylin rat pricing
H3136 Hematoxylin certified by the Biological Stain Commission rat pricing
51260 Hematoxylin for microscopy (Hist.), indicator (pH 5.0-6.0) rat pricing
K3000 Kinetin riboside proapoptotic anitproliferative plant growth regulator rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
C5134 2-Chloroadenosine human, rat pricing
A9251 Adenosine ≥99% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000675 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000675 Rosetta Predictions human pricing
NM_053294 Rosetta Predictions rat pricing
NM_009630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136635 predicted 1042
2 SASI_Hs02_00303052 predicted 868
3 SASI_Hs01_00136637 predicted 553
4 SASI_Hs02_00303053 predicted 1776
5 SASI_Hs01_00136638 predicted 938
6 SASI_Hs01_00136639 predicted 763
7 SASI_Hs01_00136640 predicted 1023
8 SASI_Hs01_00136642 predicted 568
9 SASI_Hs01_00136643 predicted 1719
10 SASI_Hs01_00136644 predicted 1691
11 SASI_Hs01_00136636 predicted 1511
12 SASI_Hs01_00136641 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058398 predicted 1627
2 SASI_Rn01_00058400 predicted 719
3 SASI_Rn01_00058401 predicted 1408
4 SASI_Rn02_00265672 predicted 990
5 SASI_Rn01_00058403 predicted 1771
6 SASI_Rn02_00265673 predicted 1293
7 SASI_Rn01_00058404 predicted 1239
8 SASI_Rn01_00058405 predicted 2094
9 SASI_Rn01_00058406 predicted 1618
10 SASI_Rn01_00058407 predicted 731
11 SASI_Rn01_00058399 predicted 1233
12 SASI_Rn01_00058402 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186660 predicted 736
2 SASI_Mm01_00186661 predicted 674
3 SASI_Mm02_00316582 predicted 1648
4 SASI_Mm02_00316583 predicted 450
5 SASI_Mm02_00316584 predicted 1799
6 SASI_Mm01_00186663 predicted 806
7 SASI_Mm02_00316585 predicted 859
8 SASI_Mm02_00316586 predicted 787
9 SASI_Mm01_00186669 predicted 750
10 SASI_Mm02_00316587 predicted 1698
11 SASI_Mm01_00186662 predicted 696
12 SASI_Mm01_00186664 predicted 349
13 SASI_Mm01_00186665 predicted 869
14 SASI_Mm01_00186666 predicted 355
15 SASI_Mm01_00186667 predicted 339
16 SASI_Mm01_00186668 predicted 497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000675
ADORA2A MISSION shRNA Bacterial Glycerol Stock
adenosine A2a receptor
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000675.4-1883s21c1
Sequence:CCGGTTCTGAGGAAGCAGATGTTTCCTCGAGGAAACATCTGCTTCCTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1031s21c1
Sequence:CCGGTGCTCATGCTGGGTGTCTATTCTCGAGAATAGACACCCAGCATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1684s21c1
Sequence:CCGGGCAGGAGTGTCCTGATGATTCCTCGAGGAATCATCAGGACACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-571s21c1
Sequence:CCGGCAGAACGTCACCAACTACTTTCTCGAGAAAGTAGTTGGTGACGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000675.4-1721s21c1
Sequence:CCGGCCTAAGGGAAGGAGATCTTTACTCGAGTAAAGATCTCCTTCCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1349s21c1
Sequence:CCGGAGACCTTCCGCAAGATCATTCCTCGAGGAATGATCTTGCGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1315s21c1
Sequence:CCGGTTCATCTACGCCTACCGTATCCTCGAGGATACGGTAGGCGTAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1280s21c1
Sequence:CCGGTCGTCCTCTCCCACACCAATTCTCGAGAATTGGTGTGGGAGAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008041    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000675.3-1953s1c1
Sequence:CCGGCCCAGAGGTGACATTTGACTTCTCGAGAAGTCAAATGTCACCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-1112s1c1
Sequence:CCGGCCACACCAATTCGGTTGTGAACTCGAGTTCACAACCGAATTGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-1025s1c1
Sequence:CCGGCCTACACATCATCAACTGCTTCTCGAGAAGCAGTTGATGATGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-697s1c1
Sequence:CCGGCCATGCTAGGTTGGAACAACTCTCGAGAGTTGTTCCAACCTAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-860s1c1
Sequence:CCGGGCTGGGTGTCTATTTGCGGATCTCGAGATCCGCAAATAGACACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000675
ADORA2A MISSION shRNA shRNA Plasmid DNA
adenosine A2a receptor
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000675.4-1883s21c1
Sequence:CCGGTTCTGAGGAAGCAGATGTTTCCTCGAGGAAACATCTGCTTCCTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1031s21c1
Sequence:CCGGTGCTCATGCTGGGTGTCTATTCTCGAGAATAGACACCCAGCATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1684s21c1
Sequence:CCGGGCAGGAGTGTCCTGATGATTCCTCGAGGAATCATCAGGACACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-571s21c1
Sequence:CCGGCAGAACGTCACCAACTACTTTCTCGAGAAAGTAGTTGGTGACGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000675.4-1721s21c1
Sequence:CCGGCCTAAGGGAAGGAGATCTTTACTCGAGTAAAGATCTCCTTCCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1349s21c1
Sequence:CCGGAGACCTTCCGCAAGATCATTCCTCGAGGAATGATCTTGCGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1315s21c1
Sequence:CCGGTTCATCTACGCCTACCGTATCCTCGAGGATACGGTAGGCGTAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1280s21c1
Sequence:CCGGTCGTCCTCTCCCACACCAATTCTCGAGAATTGGTGTGGGAGAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008041    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000675.3-1953s1c1
Sequence:CCGGCCCAGAGGTGACATTTGACTTCTCGAGAAGTCAAATGTCACCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-1112s1c1
Sequence:CCGGCCACACCAATTCGGTTGTGAACTCGAGTTCACAACCGAATTGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-1025s1c1
Sequence:CCGGCCTACACATCATCAACTGCTTCTCGAGAAGCAGTTGATGATGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-697s1c1
Sequence:CCGGCCATGCTAGGTTGGAACAACTCTCGAGAGTTGTTCCAACCTAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-860s1c1
Sequence:CCGGGCTGGGTGTCTATTTGCGGATCTCGAGATCCGCAAATAGACACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000675
ADORA2A MISSION shRNA Lentiviral Transduction Particles
adenosine A2a receptor
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000675.4-1883s21c1
Sequence:CCGGTTCTGAGGAAGCAGATGTTTCCTCGAGGAAACATCTGCTTCCTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1031s21c1
Sequence:CCGGTGCTCATGCTGGGTGTCTATTCTCGAGAATAGACACCCAGCATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1684s21c1
Sequence:CCGGGCAGGAGTGTCCTGATGATTCCTCGAGGAATCATCAGGACACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-571s21c1
Sequence:CCGGCAGAACGTCACCAACTACTTTCTCGAGAAAGTAGTTGGTGACGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000675.4-1721s21c1
Sequence:CCGGCCTAAGGGAAGGAGATCTTTACTCGAGTAAAGATCTCCTTCCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1349s21c1
Sequence:CCGGAGACCTTCCGCAAGATCATTCCTCGAGGAATGATCTTGCGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1315s21c1
Sequence:CCGGTTCATCTACGCCTACCGTATCCTCGAGGATACGGTAGGCGTAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000675.4-1280s21c1
Sequence:CCGGTCGTCCTCTCCCACACCAATTCTCGAGAATTGGTGTGGGAGAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008041    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000675.3-1953s1c1
Sequence:CCGGCCCAGAGGTGACATTTGACTTCTCGAGAAGTCAAATGTCACCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-1112s1c1
Sequence:CCGGCCACACCAATTCGGTTGTGAACTCGAGTTCACAACCGAATTGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-1025s1c1
Sequence:CCGGCCTACACATCATCAACTGCTTCTCGAGAAGCAGTTGATGATGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-697s1c1
Sequence:CCGGCCATGCTAGGTTGGAACAACTCTCGAGAGTTGTTCCAACCTAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000675.3-860s1c1
Sequence:CCGGGCTGGGTGTCTATTTGCGGATCTCGAGATCCGCAAATAGACACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009630
ADORA2A MISSION shRNA Bacterial Glycerol Stock
adenosine A2a receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-816s1c1
Sequence:CCGGCCACAGCAATTCCGTTGTCAACTCGAGTTGACAACGGAATTGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-288s1c1
Sequence:CCGGCATCGACAGATACATCGCCATCTCGAGATGGCGATGTATCTGTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-102s1c1
Sequence:CCGGGCAGAACGTCACAAACTTCTTCTCGAGAAGAAGTTTGTGACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-490s1c1
Sequence:CCGGGAGGACGTAGTACCCATGAATCTCGAGATTCATGGGTACTACGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-353s1c1
Sequence:CCGGCGAAGGGCATCATTGCGATTTCTCGAGAAATCGCAATGATGCCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009630
ADORA2A MISSION shRNA shRNA Plasmid DNA
adenosine A2a receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-816s1c1
Sequence:CCGGCCACAGCAATTCCGTTGTCAACTCGAGTTGACAACGGAATTGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-288s1c1
Sequence:CCGGCATCGACAGATACATCGCCATCTCGAGATGGCGATGTATCTGTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-102s1c1
Sequence:CCGGGCAGAACGTCACAAACTTCTTCTCGAGAAGAAGTTTGTGACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-490s1c1
Sequence:CCGGGAGGACGTAGTACCCATGAATCTCGAGATTCATGGGTACTACGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-353s1c1
Sequence:CCGGCGAAGGGCATCATTGCGATTTCTCGAGAAATCGCAATGATGCCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009630
ADORA2A MISSION shRNA Lentiviral Transduction Particles
adenosine A2a receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-816s1c1
Sequence:CCGGCCACAGCAATTCCGTTGTCAACTCGAGTTGACAACGGAATTGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-288s1c1
Sequence:CCGGCATCGACAGATACATCGCCATCTCGAGATGGCGATGTATCTGTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-102s1c1
Sequence:CCGGGCAGAACGTCACAAACTTCTTCTCGAGAAGAAGTTTGTGACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-490s1c1
Sequence:CCGGGAGGACGTAGTACCCATGAATCTCGAGATTCATGGGTACTACGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009630.1-353s1c1
Sequence:CCGGCGAAGGGCATCATTGCGATTTCTCGAGAAATCGCAATGATGCCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks