EMAIL THIS PAGE TO A FRIEND

ADORA2B

adenosine A2b receptor

106 Gene Product Result for
Synonyms: ADORA2
UniProtKB ID: P29275
Gene ID:
Human(136) Summary: This gene encodes an adenosine receptor that is a member of the G protein-coupled receptor superfamily. This integral membrane protein stimulates adenylate cyclase activity in the presence of adenosine. This protein also interacts with netrin-1, which is involved in axon elongation. The gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(11541) adenosine A2b receptor
Rat(29316) adenosine A2B receptor
Zebrafish(560100) adenosine A2b receptor
dog(403410) adenosine A2b receptor
cow(529760) adenosine A2b receptor
domestic cat(101083466) adenosine A2b receptor
chicken(395971) adenosine A2b receptor
domestic guinea pig(100727842) adenosine A2b receptor
sheep(101107715) adenosine A2b receptor
Domestic Rabbit(100008951) adenosine A2b receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
H9006 7-(β-Hydroxyethyl)theophylline solid human pricing
A28651 Alloxazine 96% human pricing
C239 CNQX disodium salt hydrate ≥98% (HPLC), solid human pricing
88310 Theophylline-7-acetic acid ≥99.0% (T) human pricing
T2879 Tyramine hydrochloride ≥98% human pricing
D5011 5′-Deoxy-5′-(methylthio)adenosine human, mouse, rat pricing
27602 Caffeine anhydrous, tested according to Ph.Eur. human, mouse, rat pricing
C0750 Caffeine powder, ReagentPlus® human, mouse, rat pricing
C8960 Caffeine BioXtra human, mouse, rat pricing
C1778 Caffeine Sigma Reference Standard, vial of 250 mg human, mouse, rat pricing
C7731 Caffeine meets USP testing specifications, anhydrous human, mouse, rat pricing
W222402 Caffeine anhydrous, 99%, FCC, FG human, mouse, rat pricing
C6035 Caffeine solution analytical standard, 1.0 mg/mL in methanol human, mouse, rat pricing
75035 Mettler-Toledo Calibration substance ME 18872, Caffeine analytical standard, for the calibration of the thermosystem 900, traceable to primary standards (LGC) human, mouse, rat pricing
T1633 Theophylline anhydrous, ≥99%, powder human, mouse, rat pricing
P2278 1,3-Dimethyl-8-phenylxanthine crystalline human, rat pricing
A022 1,3-Dipropyl-8-(p-sulfophenyl)xanthine powder human, rat pricing
A145 1-Allyl-3,7-dimethyl-8-sulfophenylxanthine solid human, rat pricing
C7938 2-Chloro-N6-cyclopentyladenosine adenosine receptor agonist human, rat pricing
D134 3,7-Dimethyl-1-propargylxanthine ≥98% (HPLC), powder human, rat pricing
E2387 5′-(N-Ethylcarboxamido)adenosine powder human, rat pricing
A013 8-(p-Sulfophenyl)theophylline hydrate solid human, rat pricing
C101 8-Cyclopentyl-1,3-dipropylxanthine solid human, rat pricing
C199 CGS-15943 solid human, rat pricing
M6316 MRS 1754 hydrate ≥98% (HPLC), solid human, rat pricing
P1784 Pentoxifylline solid human, rat pricing
R3904 Reversine ≥98% (HPLC), solid human, rat pricing
T4500 Theobromine ≥98.0% human, rat pricing
X103 Xanthine amine congener ≥96% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000676 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053361 MISSION® esiRNA esiRNA human ADORA2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000676 Rosetta Predictions human pricing
NM_017161 Rosetta Predictions rat pricing
NM_007413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020551 predicted 1488
2 SASI_Hs01_00020552 predicted 1142
3 SASI_Hs01_00020553 predicted 1208
4 SASI_Hs01_00020554 predicted 1464
5 SASI_Hs02_00303054 predicted 869
6 SASI_Hs02_00303055 predicted 1462
7 SASI_Hs01_00020557 predicted 1426
8 SASI_Hs01_00020558 predicted 1505
9 SASI_Hs01_00020559 predicted 1080
10 SASI_Hs01_00020560 predicted 913
11 SASI_Hs01_00020555 predicted 803
12 SASI_Hs01_00020556 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070043 predicted 1580
2 SASI_Rn02_00261472 predicted 1280
3 SASI_Rn01_00070045 predicted 1424
4 SASI_Rn01_00070046 predicted 1183
5 SASI_Rn01_00070047 predicted 1431
6 SASI_Rn01_00070048 predicted 1456
7 SASI_Rn01_00070049 predicted 808
8 SASI_Rn01_00070050 predicted 1299
9 SASI_Rn01_00070051 predicted 1485
10 SASI_Rn01_00070052 predicted 1591
11 SASI_Rn01_00070044 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054716 predicted 1292
2 SASI_Mm01_00054717 predicted 1014
3 SASI_Mm01_00054718 predicted 1404
4 SASI_Mm01_00054719 predicted 1311
5 SASI_Mm01_00054721 predicted 700
6 SASI_Mm01_00054722 predicted 1256
7 SASI_Mm01_00054723 predicted 1247
8 SASI_Mm02_00311557 predicted 1403
9 SASI_Mm01_00054724 predicted 1413
10 SASI_Mm01_00054725 predicted 944
11 SASI_Mm01_00054720 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007413
ADORA2B MISSION shRNA Bacterial Glycerol Stock
adenosine A2b receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-240s1c1
Sequence:CCGGCCCACCAACTACTTTCTGGTACTCGAGTACCAGAAAGTAGTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007413.2-1289s1c1
Sequence:CCGGCGTGGCTAACAAATACATTTACTCGAGTAAATGTATTTGTTAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-446s1c1
Sequence:CCGGCCCGCTCAGGTATAAAGGTTTCTCGAGAAACCTTTATACCTGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-651s1c1
Sequence:CCGGCCCATGAGCTACATGGTGTATCTCGAGATACACCATGTAGCTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-1010s1c1
Sequence:CCGGCCGCTACAGTTTCCACAAGATCTCGAGATCTTGTGGAAACTGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007413
ADORA2B MISSION shRNA shRNA Plasmid DNA
adenosine A2b receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-240s1c1
Sequence:CCGGCCCACCAACTACTTTCTGGTACTCGAGTACCAGAAAGTAGTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007413.2-1289s1c1
Sequence:CCGGCGTGGCTAACAAATACATTTACTCGAGTAAATGTATTTGTTAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-446s1c1
Sequence:CCGGCCCGCTCAGGTATAAAGGTTTCTCGAGAAACCTTTATACCTGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-651s1c1
Sequence:CCGGCCCATGAGCTACATGGTGTATCTCGAGATACACCATGTAGCTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-1010s1c1
Sequence:CCGGCCGCTACAGTTTCCACAAGATCTCGAGATCTTGTGGAAACTGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007413
ADORA2B MISSION shRNA Lentiviral Transduction Particles
adenosine A2b receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-240s1c1
Sequence:CCGGCCCACCAACTACTTTCTGGTACTCGAGTACCAGAAAGTAGTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007413.2-1289s1c1
Sequence:CCGGCGTGGCTAACAAATACATTTACTCGAGTAAATGTATTTGTTAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-446s1c1
Sequence:CCGGCCCGCTCAGGTATAAAGGTTTCTCGAGAAACCTTTATACCTGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-651s1c1
Sequence:CCGGCCCATGAGCTACATGGTGTATCTCGAGATACACCATGTAGCTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007413.2-1010s1c1
Sequence:CCGGCCGCTACAGTTTCCACAAGATCTCGAGATCTTGTGGAAACTGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000676
ADORA2B MISSION shRNA Bacterial Glycerol Stock
adenosine A2b receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000676.2-1478s1c1
Sequence:CCGGGCTAATATGTATGTGTCAGTACTCGAGTACTGACACATACATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-1269s1c1
Sequence:CCGGGCAGATGTCAAGAGTGGGAATCTCGAGATTCCCACTCTTGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-1143s1c1
Sequence:CCGGGCAATGAATATGGCCATTCTTCTCGAGAAGAATGGCCATATTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-864s1c1
Sequence:CCGGCCCATGAGCTACATGGTATATCTCGAGATATACCATGTAGCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-926s1c1
Sequence:CCGGGCTGGTGATCTACATTAAGATCTCGAGATCTTAATGTAGATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000676.2-926s21c1
Sequence:CCGGGCTGGTGATCTACATTAAGATCTCGAGATCTTAATGTAGATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000676.2-1269s21c1
Sequence:CCGGGCAGATGTCAAGAGTGGGAATCTCGAGATTCCCACTCTTGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000676.2-1478s21c1
Sequence:CCGGGCTAATATGTATGTGTCAGTACTCGAGTACTGACACATACATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000676.2-864s21c1
Sequence:CCGGCCCATGAGCTACATGGTATATCTCGAGATATACCATGTAGCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000676
ADORA2B MISSION shRNA shRNA Plasmid DNA
adenosine A2b receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000676.2-1478s1c1
Sequence:CCGGGCTAATATGTATGTGTCAGTACTCGAGTACTGACACATACATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-1269s1c1
Sequence:CCGGGCAGATGTCAAGAGTGGGAATCTCGAGATTCCCACTCTTGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-1143s1c1
Sequence:CCGGGCAATGAATATGGCCATTCTTCTCGAGAAGAATGGCCATATTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-864s1c1
Sequence:CCGGCCCATGAGCTACATGGTATATCTCGAGATATACCATGTAGCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-926s1c1
Sequence:CCGGGCTGGTGATCTACATTAAGATCTCGAGATCTTAATGTAGATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000676.2-926s21c1
Sequence:CCGGGCTGGTGATCTACATTAAGATCTCGAGATCTTAATGTAGATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000676.2-1269s21c1
Sequence:CCGGGCAGATGTCAAGAGTGGGAATCTCGAGATTCCCACTCTTGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000676.2-1478s21c1
Sequence:CCGGGCTAATATGTATGTGTCAGTACTCGAGTACTGACACATACATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000676.2-864s21c1
Sequence:CCGGCCCATGAGCTACATGGTATATCTCGAGATATACCATGTAGCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000676
ADORA2B MISSION shRNA Lentiviral Transduction Particles
adenosine A2b receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000676.2-1478s1c1
Sequence:CCGGGCTAATATGTATGTGTCAGTACTCGAGTACTGACACATACATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-1269s1c1
Sequence:CCGGGCAGATGTCAAGAGTGGGAATCTCGAGATTCCCACTCTTGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-1143s1c1
Sequence:CCGGGCAATGAATATGGCCATTCTTCTCGAGAAGAATGGCCATATTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-864s1c1
Sequence:CCGGCCCATGAGCTACATGGTATATCTCGAGATATACCATGTAGCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000676.2-926s1c1
Sequence:CCGGGCTGGTGATCTACATTAAGATCTCGAGATCTTAATGTAGATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000676.2-926s21c1
Sequence:CCGGGCTGGTGATCTACATTAAGATCTCGAGATCTTAATGTAGATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000676.2-1269s21c1
Sequence:CCGGGCAGATGTCAAGAGTGGGAATCTCGAGATTCCCACTCTTGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000676.2-1478s21c1
Sequence:CCGGGCTAATATGTATGTGTCAGTACTCGAGTACTGACACATACATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000676.2-864s21c1
Sequence:CCGGCCCATGAGCTACATGGTATATCTCGAGATATACCATGTAGCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks