EMAIL THIS PAGE TO A FRIEND

ADORA3

adenosine A3 receptor

206 Gene Product Result for
Synonyms: A3AR AD026 bA552M11.5
UniProtKB ID: P33765, A2A3P4, Q6UWU0, Q9BYZ1
Gene ID:
Human(140) Summary: This gene encodes a protein that belongs to the family of adenosine receptors, which are G-protein-coupled receptors that are involved in a variety of intracellular signaling pathways and physiological functions. The receptor encoded by this gene mediates a sustained cardioprotective function during cardiac ischemia, it is involved in the inhibition of neutrophil degranulation in neutrophil-mediated tissue injury, it has been implicated in both neuroprotective and neurodegenerative effects, and it may also mediate both cell proliferation and cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11542) adenosine A3 receptor
Rat(25370) adenosine A3 receptor
chicken(373956) adenosine A3 receptor
domestic cat(101094689) adenosine A3 receptor
dog(403805) adenosine A3 receptor
cow(780806) adenosine A3 receptor
sheep(443330) adenosine A3 receptor
Domestic Rabbit(100008725) adenosine A3 receptor
naked mole-rat(101697269) adenosine A3 receptor
domestic guinea pig(100725432) adenosine A3 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
B152 N6-Benzyl-5′-N-ethylcarboxamidoadenosine solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C239 CNQX disodium salt hydrate ≥98% (HPLC), solid human pricing
T2879 Tyramine hydrochloride ≥98% human pricing
V5888 VUF 5574 human pricing
17799 Rhamnetin analytical standard human, mouse pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
D5011 5′-Deoxy-5′-(methylthio)adenosine human, mouse, rat pricing
A3145 Apigenin ≥97% (TLC), from parsley, powder human, mouse, rat pricing
10798 Apigenin ≥95.0% (HPLC) human, mouse, rat pricing
SMB00702 Apigenin ≥97% (TLC), from citrus New human, mouse, rat pricing
27602 Caffeine anhydrous, tested according to Ph.Eur. human, mouse, rat pricing
C0750 Caffeine powder, ReagentPlus® human, mouse, rat pricing
C8960 Caffeine BioXtra human, mouse, rat pricing
C1778 Caffeine Sigma Reference Standard, vial of 250 mg human, mouse, rat pricing
C7731 Caffeine meets USP testing specifications, anhydrous human, mouse, rat pricing
W222402 Caffeine anhydrous, 99%, FCC, FG human, mouse, rat pricing
C6035 Caffeine solution analytical standard, 1.0 mg/mL in methanol human, mouse, rat pricing
C1530 Cyclopiazonic acid from Penicillium cyclopium ≥98% (HPLC), powder human, mouse, rat pricing
102032 Flavanone 98% human, mouse, rat pricing
F2003 Flavone human, mouse, rat pricing
75035 Mettler-Toledo Calibration substance ME 18872, Caffeine analytical standard, for the calibration of the thermosystem 900, traceable to primary standards (LGC) human, mouse, rat pricing
C8031 N6-Cyclopentyladenosine solid human, mouse, rat pricing
N7634 Nifedipine ≥98% (HPLC), powder human, mouse, rat pricing
T1633 Theophylline anhydrous, ≥99%, powder human, mouse, rat pricing
B133 (S)-(−)-Bay K8644 ≥98% (HPLC), solid human, rat pricing
P2278 1,3-Dimethyl-8-phenylxanthine crystalline human, rat pricing
A022 1,3-Dipropyl-8-(p-sulfophenyl)xanthine powder human, rat pricing
C4438 2-Chloro-2′-deoxyadenosine antileukemic human, rat pricing
C7938 2-Chloro-N6-cyclopentyladenosine adenosine receptor agonist human, rat pricing
C5134 2-Chloroadenosine human, rat pricing
F2773 2-Fluoroadenine-9-β-D-arabinofuranoside DNA synthesis and methylation inhibitor human, rat pricing
656402 2-Fluoroadenosine 97% human, rat pricing
663115 2-Iodoadenosine 97% human, rat pricing
E2387 5′-(N-Ethylcarboxamido)adenosine powder human, rat pricing
A013 8-(p-Sulfophenyl)theophylline hydrate solid human, rat pricing
C101 8-Cyclopentyl-1,3-dipropylxanthine solid human, rat pricing
N5757 α-Naphthoflavone human, rat pricing
A236 AB-MECA solid human, rat pricing
A9251 Adenosine ≥99% human, rat pricing
A4036 Adenosine suitable for cell culture, BioReagent human, rat pricing
C199 CGS-15943 solid human, rat pricing
C277 Chloro-IB-MECA solid, ≥98% (HPLC) human, rat pricing
282200 Galangin autophagy inducing flavonoid human, rat pricing
I145 I-AB-MECA solid human, rat pricing
I146 IB-MECA solid, ≥98% (HPLC) human, rat pricing
M228 MRS 1220 solid human, rat pricing
M1809 MRS 1523 >98% (HPLC) human, rat pricing
M6316 MRS 1754 hydrate ≥98% (HPLC), solid human, rat pricing
A202 N6-2-(4-Aminophenyl)ethyladenosine >95% human, rat pricing
13155 N6-Benzyladenosine ≥99.0% human, rat pricing
C9901 N6-Cyclohexyladenosine human, rat pricing
N149 Nimodipine human, rat pricing
N144 Nitrendipine >95%, powder human, rat pricing
R3904 Reversine ≥98% (HPLC), solid human, rat pricing
T4500 Theobromine ≥98.0% human, rat pricing
X103 Xanthine amine congener ≥96% (HPLC) human, rat pricing
D8296 3-Deazaadenosine rat pricing
K3000 Kinetin riboside proapoptotic anitproliferative plant growth regulator rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
D5385 1,7-Dimethylxanthine ~98%, solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000677 Rosetta Predictions human pricing
NM_001081976 Rosetta Predictions human pricing
NM_020683 Rosetta Predictions human pricing
NM_012896 Rosetta Predictions rat pricing
NM_009631 Rosetta Predictions mouse pricing
NM_027025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303056 predicted 781
2 SASI_Hs01_00090033 predicted 800
3 SASI_Hs02_00303057 predicted 891
4 SASI_Hs02_00303058 predicted 799
5 SASI_Hs02_00303059 predicted 805
6 SASI_Hs02_00303060 predicted 894
7 SASI_Hs02_00303061 predicted 897
8 SASI_Hs02_00303062 predicted 827
9 SASI_Hs02_00303063 predicted 890
10 SASI_Hs02_00303064 predicted 836
11 SASI_Hs01_00090030 predicted 1738
12 SASI_Hs01_00090031 predicted 1343
13 SASI_Hs01_00090032 predicted 1282
14 SASI_Hs01_00090034 predicted 1395
15 SASI_Hs01_00090035 predicted 1414
16 SASI_Hs01_00090036 predicted 913
17 SASI_Hs01_00090037 predicted 1725
18 SASI_Hs01_00090038 predicted 1286
19 SASI_Hs01_00090039 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316603 predicted 898
2 SASI_Hs02_00316604 predicted 929
3 SASI_Hs02_00316605 predicted 853
4 SASI_Hs02_00316606 predicted 684
5 SASI_Hs02_00316607 predicted 808
6 SASI_Hs02_00316608 predicted 652
7 SASI_Hs02_00316609 predicted 539
8 SASI_Hs02_00316610 predicted 439
9 SASI_Hs02_00316611 predicted 614
10 SASI_Hs02_00316612 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022272 predicted 1880
2 SASI_Hs02_00353676 predicted 1916
3 SASI_Hs02_00353677 predicted 1835
4 SASI_Hs02_00353678 predicted 1674
5 SASI_Hs01_00022275 predicted 1797
6 SASI_Hs01_00022276 predicted 1639
7 SASI_Hs02_00353679 predicted 1530
8 SASI_Hs01_00022278 predicted 1424
9 SASI_Hs02_00353680 predicted 1604
10 SASI_Hs02_00353681 predicted 1920
11 SASI_Hs01_00022273 predicted 888
12 SASI_Hs01_00022274 predicted 886
13 SASI_Hs01_00022277 predicted 1042
14 SASI_Hs01_00022279 predicted 1149
15 SASI_Hs01_00022280 predicted 623
16 SASI_Hs01_00022281 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084749 predicted 777
2 SASI_Rn01_00084750 predicted 659
3 SASI_Rn01_00084751 predicted 1152
4 SASI_Rn01_00084752 predicted 945
5 SASI_Rn01_00084753 predicted 933
6 SASI_Rn01_00084754 predicted 555
7 SASI_Rn01_00084755 predicted 1100
8 SASI_Rn01_00084756 predicted 939
9 SASI_Rn01_00084757 predicted 991
10 SASI_Rn01_00084758 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316588 predicted 768
2 SASI_Mm02_00316589 predicted 501
3 SASI_Mm02_00316590 predicted 498
4 SASI_Mm01_00135643 predicted 585
5 SASI_Mm02_00316591 predicted 1022
6 SASI_Mm01_00135645 predicted 1207
7 SASI_Mm02_00316592 predicted 993
8 SASI_Mm01_00135646 predicted 538
9 SASI_Mm02_00316593 predicted 989
10 SASI_Mm01_00135648 predicted 883
11 SASI_Mm01_00135644 predicted 350
12 SASI_Mm01_00135647 predicted 617
13 SASI_Mm01_00135649 predicted 926
14 SASI_Mm01_00135650 predicted 833
15 SASI_Mm01_00135651 predicted 620
16 SASI_Mm01_00135652 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070062 predicted 330
2 SASI_Mm01_00070063 predicted 625
3 SASI_Mm01_00070064 predicted 431
4 SASI_Mm01_00070065 predicted 393
5 SASI_Mm01_00070066 predicted 456
6 SASI_Mm02_00331413 predicted 246
7 SASI_Mm01_00070067 predicted 616
8 SASI_Mm01_00070068 predicted 472
9 SASI_Mm01_00070070 predicted 494
10 SASI_Mm01_00070071 predicted 605
11 SASI_Mm01_00070069 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009631
ADORA3 MISSION shRNA Bacterial Glycerol Stock
adenosine A3 receptor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009631.3-511s21c1
Sequence:CCGGGAGGACCACCACGTTCTATTTCTCGAGAAATAGAACGTGGTGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009631.3-1374s21c1
Sequence:CCGGTTCGCATGTGGTATCAGTAAACTCGAGTTTACTGATACCACATGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009631.3-1527s21c1
Sequence:CCGCTTGAGCTTCTCTAATTCAATTCTCGAGAATTGAATTAGAGAAGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-1153s1c1
Sequence:CCGGCCTATTGTCTACGCCTGCAAACTCGAGTTTGCAGGCGTAGACAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-828s1c1
Sequence:CCGGCGTGGTCAGTTTGGATTACATCTCGAGATGTAATCCAAACTGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-1232s1c1
Sequence:CCGGCCTCAGATTCTTTGGACTCAACTCGAGTTGAGTCCAAAGAATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009631.1-1545s1c1
Sequence:CCGGCCAGACAAAGAAGTAATGGAACTCGAGTTCCATTACTTCTTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-540s1c1
Sequence:CCGGGCAAGTCAAGATGCACTTCTACTCGAGTAGAAGTGCATCTTGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009631
ADORA3 MISSION shRNA shRNA Plasmid DNA
adenosine A3 receptor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009631.3-511s21c1
Sequence:CCGGGAGGACCACCACGTTCTATTTCTCGAGAAATAGAACGTGGTGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009631.3-1374s21c1
Sequence:CCGGTTCGCATGTGGTATCAGTAAACTCGAGTTTACTGATACCACATGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009631.3-1527s21c1
Sequence:CCGCTTGAGCTTCTCTAATTCAATTCTCGAGAATTGAATTAGAGAAGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-1153s1c1
Sequence:CCGGCCTATTGTCTACGCCTGCAAACTCGAGTTTGCAGGCGTAGACAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-828s1c1
Sequence:CCGGCGTGGTCAGTTTGGATTACATCTCGAGATGTAATCCAAACTGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-1232s1c1
Sequence:CCGGCCTCAGATTCTTTGGACTCAACTCGAGTTGAGTCCAAAGAATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009631.1-1545s1c1
Sequence:CCGGCCAGACAAAGAAGTAATGGAACTCGAGTTCCATTACTTCTTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-540s1c1
Sequence:CCGGGCAAGTCAAGATGCACTTCTACTCGAGTAGAAGTGCATCTTGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009631
ADORA3 MISSION shRNA Lentiviral Transduction Particles
adenosine A3 receptor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009631.3-511s21c1
Sequence:CCGGGAGGACCACCACGTTCTATTTCTCGAGAAATAGAACGTGGTGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009631.3-1374s21c1
Sequence:CCGGTTCGCATGTGGTATCAGTAAACTCGAGTTTACTGATACCACATGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009631.3-1527s21c1
Sequence:CCGCTTGAGCTTCTCTAATTCAATTCTCGAGAATTGAATTAGAGAAGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-1153s1c1
Sequence:CCGGCCTATTGTCTACGCCTGCAAACTCGAGTTTGCAGGCGTAGACAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-828s1c1
Sequence:CCGGCGTGGTCAGTTTGGATTACATCTCGAGATGTAATCCAAACTGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-1232s1c1
Sequence:CCGGCCTCAGATTCTTTGGACTCAACTCGAGTTGAGTCCAAAGAATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009631.1-1545s1c1
Sequence:CCGGCCAGACAAAGAAGTAATGGAACTCGAGTTCCATTACTTCTTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009631.1-540s1c1
Sequence:CCGGGCAAGTCAAGATGCACTTCTACTCGAGTAGAAGTGCATCTTGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020683
ADORA3 MISSION shRNA Bacterial Glycerol Stock
adenosine A3 receptor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078087    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-756s1c1
Sequence:CCGGCTCCAAAGGAAATGGCTCCTACTCGAGTAGGAGCCATTTCCTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078083    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-902s1c1
Sequence:CCGGCCCTCTATCCTTGACAACAATCTCGAGATTGTTGTCAAGGATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078085    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-322s1c1
Sequence:CCGGCCGTGACTACTGCAACATCATCTCGAGATGATGTTGCAGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078086    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-265s1c1
Sequence:CCGGCTGCAACTACAATGCCCACTACTCGAGTAGTGGGCATTGTAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078084    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-496s1c1
Sequence:CCGGGCTGATTGTAACTGACGACAACTCGAGTTGTCGTCAGTTACAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020683
ADORA3 MISSION shRNA shRNA Plasmid DNA
adenosine A3 receptor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078087    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-756s1c1
Sequence:CCGGCTCCAAAGGAAATGGCTCCTACTCGAGTAGGAGCCATTTCCTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078083    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-902s1c1
Sequence:CCGGCCCTCTATCCTTGACAACAATCTCGAGATTGTTGTCAAGGATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078085    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-322s1c1
Sequence:CCGGCCGTGACTACTGCAACATCATCTCGAGATGATGTTGCAGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078086    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-265s1c1
Sequence:CCGGCTGCAACTACAATGCCCACTACTCGAGTAGTGGGCATTGTAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078084    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-496s1c1
Sequence:CCGGGCTGATTGTAACTGACGACAACTCGAGTTGTCGTCAGTTACAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020683
ADORA3 MISSION shRNA Lentiviral Transduction Particles
adenosine A3 receptor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078087    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-756s1c1
Sequence:CCGGCTCCAAAGGAAATGGCTCCTACTCGAGTAGGAGCCATTTCCTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078083    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-902s1c1
Sequence:CCGGCCCTCTATCCTTGACAACAATCTCGAGATTGTTGTCAAGGATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078085    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-322s1c1
Sequence:CCGGCCGTGACTACTGCAACATCATCTCGAGATGATGTTGCAGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078086    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-265s1c1
Sequence:CCGGCTGCAACTACAATGCCCACTACTCGAGTAGTGGGCATTGTAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078084    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_020683.3-496s1c1
Sequence:CCGGGCTGATTGTAACTGACGACAACTCGAGTTGTCGTCAGTTACAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027025
ADORA3 MISSION shRNA Bacterial Glycerol Stock
adenosine A3 receptor
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000202348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027025.1-388s1c1
Sequence:CCGGGATACCGGAAACCAACTCGTTCTCGAGAACGAGTTGGTTTCCGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027025.1-697s1c1
Sequence:CCGGCGAAGCCAAAGAAATAGAGAACTCGAGTTCTCTATTTCTTTGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027025.1-335s1c1
Sequence:CCGGCGTGCAACATTATTGCCTTCACTCGAGTGAAGGCAATAATGTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027025
ADORA3 MISSION shRNA shRNA Plasmid DNA
adenosine A3 receptor
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000202348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027025.1-388s1c1
Sequence:CCGGGATACCGGAAACCAACTCGTTCTCGAGAACGAGTTGGTTTCCGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027025.1-697s1c1
Sequence:CCGGCGAAGCCAAAGAAATAGAGAACTCGAGTTCTCTATTTCTTTGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027025.1-335s1c1
Sequence:CCGGCGTGCAACATTATTGCCTTCACTCGAGTGAAGGCAATAATGTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027025
ADORA3 MISSION shRNA Lentiviral Transduction Particles
adenosine A3 receptor
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000202348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027025.1-388s1c1
Sequence:CCGGGATACCGGAAACCAACTCGTTCTCGAGAACGAGTTGGTTTCCGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027025.1-697s1c1
Sequence:CCGGCGAAGCCAAAGAAATAGAGAACTCGAGTTCTCTATTTCTTTGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027025.1-335s1c1
Sequence:CCGGCGTGCAACATTATTGCCTTCACTCGAGTGAAGGCAATAATGTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000677
ADORA3 MISSION shRNA Bacterial Glycerol Stock
adenosine A3 receptor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000677.2-1997s1c1
Sequence:CCGGCCCAATAGAAGAATAAGTCATCTCGAGATGACTTATTCTTCTATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1277s1c1
Sequence:CCGGCGTCATGAGAATGGACTACATCTCGAGATGTAGTCCATTCTCATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1602s1c1
Sequence:CCGGCCTATCGTCTATGCCTATAAACTCGAGTTTATAGGCATAGACGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1452s1c1
Sequence:CCGGGCTAAGTCCTTGTTTCTGGTTCTCGAGAACCAGAAACAAGGACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1350s1c1
Sequence:CCGGGCCATCTATCTTGACATCTTTCTCGAGAAAGATGTCAAGATAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000677
ADORA3 MISSION shRNA shRNA Plasmid DNA
adenosine A3 receptor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000677.2-1997s1c1
Sequence:CCGGCCCAATAGAAGAATAAGTCATCTCGAGATGACTTATTCTTCTATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1277s1c1
Sequence:CCGGCGTCATGAGAATGGACTACATCTCGAGATGTAGTCCATTCTCATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1602s1c1
Sequence:CCGGCCTATCGTCTATGCCTATAAACTCGAGTTTATAGGCATAGACGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1452s1c1
Sequence:CCGGGCTAAGTCCTTGTTTCTGGTTCTCGAGAACCAGAAACAAGGACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1350s1c1
Sequence:CCGGGCCATCTATCTTGACATCTTTCTCGAGAAAGATGTCAAGATAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000677
ADORA3 MISSION shRNA Lentiviral Transduction Particles
adenosine A3 receptor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000677.2-1997s1c1
Sequence:CCGGCCCAATAGAAGAATAAGTCATCTCGAGATGACTTATTCTTCTATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1277s1c1
Sequence:CCGGCGTCATGAGAATGGACTACATCTCGAGATGTAGTCCATTCTCATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1602s1c1
Sequence:CCGGCCTATCGTCTATGCCTATAAACTCGAGTTTATAGGCATAGACGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1452s1c1
Sequence:CCGGGCTAAGTCCTTGTTTCTGGTTCTCGAGAACCAGAAACAAGGACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000677.2-1350s1c1
Sequence:CCGGGCCATCTATCTTGACATCTTTCTCGAGAAAGATGTCAAGATAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks