EMAIL THIS PAGE TO A FRIEND

ADPGK

ADP-dependent glucokinase

111 Gene Product Result for
Synonyms: 2610017G09Rik ADP-GK
UniProtKB ID: Q9BRR6, Q49AU7, Q8NBI1, Q8WZ90, Q96NF8, Q9H0A7
Gene ID:
Human(83440) Summary: ADPGK (EC 2.7.1.147) catalyzes the ADP-dependent phosphorylation of glucose to glucose-6-phosphate and may play a role in glycolysis, possibly during ischemic conditions (Ronimus and Morgan, 2004 [PubMed 14975750]
Mouse(72141) ADP-dependent glucokinase
Rat(315722) ADP-dependent glucokinase
Zebrafish(557919) ADP-dependent glucokinase
chicken(415317) ADP-dependent glucokinase
cow(518158) ADP-dependent glucokinase
Horse(100052166) ADP-dependent glucokinase
domestic cat(101088581) ADP-dependent glucokinase
dog(478360) ADP-dependent glucokinase
domestic guinea pig(100718903) ADP-dependent glucokinase
naked mole-rat(101717458) ADP-dependent glucokinase
sheep(101116836) ADP-dependent glucokinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028121 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028121 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028121 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031284 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031284 Rosetta Predictions human pricing
NR_023318 Rosetta Predictions human pricing
NR_023319 Rosetta Predictions human pricing
NM_001100723 Rosetta Predictions rat pricing
NM_028121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129346 predicted 1416
2 SASI_Hs01_00129347 predicted 1618
3 SASI_Hs01_00129348 predicted 1675
4 SASI_Hs01_00129349 predicted 1383
5 SASI_Hs01_00129350 predicted 1534
6 SASI_Hs01_00129351 predicted 1029
7 SASI_Hs01_00129352 predicted 640
8 SASI_Hs01_00129353 predicted 1506
9 SASI_Hs01_00129354 predicted 1563
10 SASI_Hs01_00129355 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381652 predicted 1824
2 SASI_Hs02_00381653 predicted 2406
3 SASI_Hs02_00381654 predicted 1890
4 SASI_Hs02_00381655 predicted 1962
5 SASI_Hs02_00381656 predicted 1590
6 SASI_Hs02_00381657 predicted 856
7 SASI_Hs02_00381658 predicted 1719
8 SASI_Hs02_00381659 predicted 1776
9 SASI_Hs02_00381660 predicted 1833
10 SASI_Hs02_00381661 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381662 predicted 1325
2 SASI_Hs02_00381663 predicted 1916
3 SASI_Hs02_00381664 predicted 1390
4 SASI_Hs02_00381665 predicted 1455
5 SASI_Hs02_00381666 predicted 1089
6 SASI_Hs02_00381667 predicted 1247
7 SASI_Hs02_00381668 predicted 1220
8 SASI_Hs02_00381669 predicted 1277
9 SASI_Hs02_00381670 predicted 1749
10 SASI_Hs02_00381671 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210388 predicted 449
2 SASI_Rn02_00210389 predicted 1592
3 SASI_Rn02_00210390 predicted 955
4 SASI_Rn02_00210391 predicted 1545
5 SASI_Rn02_00210392 predicted 931
6 SASI_Rn02_00210393 predicted 644
7 SASI_Rn02_00210394 predicted 269
8 SASI_Rn02_00210395 predicted 589
9 SASI_Rn02_00210396 predicted 1581
10 SASI_Rn02_00210397 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101627 predicted 1627
2 SASI_Mm01_00101628 predicted 1396
3 SASI_Mm01_00101629 predicted 1561
4 SASI_Mm01_00101630 predicted 378
5 SASI_Mm01_00101631 predicted 631
6 SASI_Mm01_00101632 predicted 472
7 SASI_Mm01_00101633 predicted 1294
8 SASI_Mm01_00101634 predicted 1605
9 SASI_Mm01_00101635 predicted 984
10 SASI_Mm02_00333379 predicted 1597
11 SASI_Mm01_00101626 predicted 1128
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028121
VALIDATED
ADPGK MISSION shRNA Bacterial Glycerol Stock
ADP-dependent glucokinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-1347s1c1
Sequence:CCGGCGGTTCCAGGATTGTATTGAACTCGAGTTCAATACAATCCTGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-508s1c1
Sequence:CCGGGCTTTAATTGGACAGAGGTTTCTCGAGAAACCTCTGTCCAATTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-475s1c1
Sequence:CCGGCCAGGAGCTCAGCATTATGTACTCGAGTACATAATGCTGAGCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-1318s1c1
Sequence:CCGGCAGGAGTTTACGACATCCCATCTCGAGATGGGATGTCGTAAACTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-1419s1c1
Sequence:CCGGCACACCTGTGTTGGTGTGTAACTCGAGTTACACACCAACACAGGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-510s21c1
Sequence:CCGGCCAGGAGCTCAGCATTATGTACTCGAGTACATAATGCTGAGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-1382s21c1
Sequence:CCGGCGGTTCCAGGATTGTATTGAACTCGAGTTCAATACAATCCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-1353s21c1
Sequence:CCGGCAGGAGTTTACGACATCCCATCTCGAGATGGGATGTCGTAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-543s21c1
Sequence:CCGGGCTTTAATTGGACAGAGGTTTCTCGAGAAACCTCTGTCCAATTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028121.2-1636s21c1
Sequence:CCGGGAACAGTTCCTAGATCAAATTCTCGAGAATTTGATCTAGGAACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028121
VALIDATED
ADPGK MISSION shRNA shRNA Plasmid DNA
ADP-dependent glucokinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-1347s1c1
Sequence:CCGGCGGTTCCAGGATTGTATTGAACTCGAGTTCAATACAATCCTGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-508s1c1
Sequence:CCGGGCTTTAATTGGACAGAGGTTTCTCGAGAAACCTCTGTCCAATTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-475s1c1
Sequence:CCGGCCAGGAGCTCAGCATTATGTACTCGAGTACATAATGCTGAGCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-1318s1c1
Sequence:CCGGCAGGAGTTTACGACATCCCATCTCGAGATGGGATGTCGTAAACTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-1419s1c1
Sequence:CCGGCACACCTGTGTTGGTGTGTAACTCGAGTTACACACCAACACAGGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-510s21c1
Sequence:CCGGCCAGGAGCTCAGCATTATGTACTCGAGTACATAATGCTGAGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-1382s21c1
Sequence:CCGGCGGTTCCAGGATTGTATTGAACTCGAGTTCAATACAATCCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-1353s21c1
Sequence:CCGGCAGGAGTTTACGACATCCCATCTCGAGATGGGATGTCGTAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-543s21c1
Sequence:CCGGGCTTTAATTGGACAGAGGTTTCTCGAGAAACCTCTGTCCAATTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028121.2-1636s21c1
Sequence:CCGGGAACAGTTCCTAGATCAAATTCTCGAGAATTTGATCTAGGAACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028121
VALIDATED
ADPGK MISSION shRNA Lentiviral Transduction Particles
ADP-dependent glucokinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-1347s1c1
Sequence:CCGGCGGTTCCAGGATTGTATTGAACTCGAGTTCAATACAATCCTGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-508s1c1
Sequence:CCGGGCTTTAATTGGACAGAGGTTTCTCGAGAAACCTCTGTCCAATTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-475s1c1
Sequence:CCGGCCAGGAGCTCAGCATTATGTACTCGAGTACATAATGCTGAGCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-1318s1c1
Sequence:CCGGCAGGAGTTTACGACATCCCATCTCGAGATGGGATGTCGTAAACTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028121.1-1419s1c1
Sequence:CCGGCACACCTGTGTTGGTGTGTAACTCGAGTTACACACCAACACAGGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-510s21c1
Sequence:CCGGCCAGGAGCTCAGCATTATGTACTCGAGTACATAATGCTGAGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-1382s21c1
Sequence:CCGGCGGTTCCAGGATTGTATTGAACTCGAGTTCAATACAATCCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-1353s21c1
Sequence:CCGGCAGGAGTTTACGACATCCCATCTCGAGATGGGATGTCGTAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028121.2-543s21c1
Sequence:CCGGGCTTTAATTGGACAGAGGTTTCTCGAGAAACCTCTGTCCAATTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028121.2-1636s21c1
Sequence:CCGGGAACAGTTCCTAGATCAAATTCTCGAGAATTTGATCTAGGAACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031284
VALIDATED
ADPGK MISSION shRNA Bacterial Glycerol Stock
ADP-dependent glucokinase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031284.3-995s1c1
Sequence:CCGGGCTGAATGAACAGGAGCTGTTCTCGAGAACAGCTCCTGTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-1418s1c1
Sequence:CCGGCACACCAGTATTGGTGTGTAACTCGAGTTACACACCAATACTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-1498s1c1
Sequence:CCGGCGGAAGTACACCCTCACTATTCTCGAGAATAGTGAGGGTGTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-507s1c1
Sequence:CCGGGCAGCTTTAATTGGACAGAAACTCGAGTTTCTGTCCAATTAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-425s1c1
Sequence:CCGGCTTCAGTGATAAGGAAACTTTCTCGAGAAAGTTTCCTTATCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.3-1149s1c1
Sequence:CCGGGATCTCACCAGGATCCATTTCCTCGAGGAAATGGATCCTGGTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.3-2231s1c1
Sequence:CCGGGCCTAGCTTTGGATGTGCTTTCTCGAGAAAGCACATCCAAAGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.3-1943s1c1
Sequence:CCGGGCAAGGATCATGATTTCCATTCTCGAGAATGGAAATCATGATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031284.4-922s1c1
Sequence:CCGGGAGACTCTTGGAGGTTGTAACCTCGAGGTTACAACCTCCAAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.4-594s1c1
Sequence:CCGGTTGCAGCCAACTCAGATTTAACTCGAGTTAAATCTGAGTTGGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031284
VALIDATED
ADPGK MISSION shRNA shRNA Plasmid DNA
ADP-dependent glucokinase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031284.3-995s1c1
Sequence:CCGGGCTGAATGAACAGGAGCTGTTCTCGAGAACAGCTCCTGTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-1418s1c1
Sequence:CCGGCACACCAGTATTGGTGTGTAACTCGAGTTACACACCAATACTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-1498s1c1
Sequence:CCGGCGGAAGTACACCCTCACTATTCTCGAGAATAGTGAGGGTGTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-507s1c1
Sequence:CCGGGCAGCTTTAATTGGACAGAAACTCGAGTTTCTGTCCAATTAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-425s1c1
Sequence:CCGGCTTCAGTGATAAGGAAACTTTCTCGAGAAAGTTTCCTTATCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.3-1149s1c1
Sequence:CCGGGATCTCACCAGGATCCATTTCCTCGAGGAAATGGATCCTGGTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.3-2231s1c1
Sequence:CCGGGCCTAGCTTTGGATGTGCTTTCTCGAGAAAGCACATCCAAAGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.3-1943s1c1
Sequence:CCGGGCAAGGATCATGATTTCCATTCTCGAGAATGGAAATCATGATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031284.4-922s1c1
Sequence:CCGGGAGACTCTTGGAGGTTGTAACCTCGAGGTTACAACCTCCAAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.4-594s1c1
Sequence:CCGGTTGCAGCCAACTCAGATTTAACTCGAGTTAAATCTGAGTTGGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031284
VALIDATED
ADPGK MISSION shRNA Lentiviral Transduction Particles
ADP-dependent glucokinase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031284.3-995s1c1
Sequence:CCGGGCTGAATGAACAGGAGCTGTTCTCGAGAACAGCTCCTGTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-1418s1c1
Sequence:CCGGCACACCAGTATTGGTGTGTAACTCGAGTTACACACCAATACTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-1498s1c1
Sequence:CCGGCGGAAGTACACCCTCACTATTCTCGAGAATAGTGAGGGTGTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-507s1c1
Sequence:CCGGGCAGCTTTAATTGGACAGAAACTCGAGTTTCTGTCCAATTAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031284.3-425s1c1
Sequence:CCGGCTTCAGTGATAAGGAAACTTTCTCGAGAAAGTTTCCTTATCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.3-1149s1c1
Sequence:CCGGGATCTCACCAGGATCCATTTCCTCGAGGAAATGGATCCTGGTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.3-2231s1c1
Sequence:CCGGGCCTAGCTTTGGATGTGCTTTCTCGAGAAAGCACATCCAAAGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.3-1943s1c1
Sequence:CCGGGCAAGGATCATGATTTCCATTCTCGAGAATGGAAATCATGATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031284.4-922s1c1
Sequence:CCGGGAGACTCTTGGAGGTTGTAACCTCGAGGTTACAACCTCCAAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031284.4-594s1c1
Sequence:CCGGTTGCAGCCAACTCAGATTTAACTCGAGTTAAATCTGAGTTGGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks