EMAIL THIS PAGE TO A FRIEND

ADPRH

ADP-ribosylarginine hydrolase

170 Gene Product Result for
Synonyms: ARH1
UniProtKB ID: P54922, B2R8H1, D3DN83
Gene ID:
Human(141) Summary: The enzyme encoded by this gene catalyzes removal of mono-ADP-ribose from arginine residues of proteins in the ADP-ribosylation cycle. Unlike the rat and mouse enzymes, which require DTT for maximal activity, the human enzyme is DTT-independent. [provided by RefSeq, Jul 2008]
Mouse(11544) ADP-ribosylarginine hydrolase
Rat(25371) ADP-ribosylarginine hydrolase
Zebrafish(445059) ADP-ribosylarginine hydrolase
dog(487995) ADP-ribosylarginine hydrolase
cow(525738) ADP-ribosylarginine hydrolase
domestic cat(101101330) ADP-ribosylarginine hydrolase
chicken(418452) ADP-ribosylarginine hydrolase
sheep(101106222) ADP-ribosylarginine hydrolase
naked mole-rat(101705433) ADP-ribosylarginine hydrolase
domestic guinea pig(100713280) ADP-ribosylarginine hydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074581 MISSION® esiRNA esiRNA human ADPRH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001125 Rosetta Predictions human pricing
NM_183325 Rosetta Predictions rat pricing
NM_007414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031379 predicted 919
2 SASI_Hs01_00031380 predicted 450
3 SASI_Hs01_00031381 predicted 1304
4 SASI_Hs01_00031382 predicted 1037
5 SASI_Hs01_00031383 predicted 1311
6 SASI_Hs01_00031384 predicted 1124
7 SASI_Hs01_00031386 predicted 916
8 SASI_Hs01_00031388 predicted 1319
9 SASI_Hs02_00327984 predicted 722
10 SASI_Hs02_00327985 predicted 882
11 SASI_Hs01_00031385 predicted 925
12 SASI_Hs01_00031387 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045770 predicted 1133
2 SASI_Rn01_00045771 predicted 376
3 SASI_Rn01_00045772 predicted 223
4 SASI_Rn01_00045773 predicted 506
5 SASI_Rn01_00045774 predicted 391
6 SASI_Rn01_00045775 predicted 199
7 SASI_Rn01_00045776 predicted 1095
8 SASI_Rn01_00045777 predicted 1146
9 SASI_Rn01_00045778 predicted 266
10 SASI_Rn01_00045779 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175806 predicted 436
2 SASI_Mm02_00311558 predicted 755
3 SASI_Mm01_00175807 predicted 1155
4 SASI_Mm01_00175808 predicted 567
5 SASI_Mm01_00175809 predicted 902
6 SASI_Mm01_00175810 predicted 833
7 SASI_Mm01_00175811 predicted 256
8 SASI_Mm01_00175812 predicted 364
9 SASI_Mm01_00175813 predicted 1181
10 SASI_Mm01_00175814 predicted 451
11 SASI_Mm01_00175815 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001125
ADPRH MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylarginine hydrolase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001125.2-1574s21c1
Sequence:CCGGGTCCTTTAGCTCAATTGATAGCTCGAGCTATCAATTGAGCTAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001125.2-1798s21c1
Sequence:CCGGGAAGGGAAGAGAGCTAGTATGCTCGAGCATACTAGCTCTCTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001125.2-1755s21c1
Sequence:CCGGGATTCCAGGAAATACCGATATCTCGAGATATCGGTATTTCCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-1271s1c1
Sequence:CCGGCCCTCCAACTATGAGAAACTACTCGAGTAGTTTCTCATAGTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-1326s1c1
Sequence:CCGGCTTTATATTCTCTCGGGTCAACTCGAGTTGACCCGAGAGAATATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-1033s1c1
Sequence:CCGGCCCTGAGTCTTTCGGTGTGAACTCGAGTTCACACCGAAAGACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-913s1c1
Sequence:CCGGCATTGTCCAATCAGGCTACTTCTCGAGAAGTAGCCTGATTGGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-518s1c1
Sequence:CCGGCCTAAGTTGACTCAACTGTATCTCGAGATACAGTTGAGTCAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001125
ADPRH MISSION shRNA shRNA Plasmid DNA
ADP-ribosylarginine hydrolase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001125.2-1574s21c1
Sequence:CCGGGTCCTTTAGCTCAATTGATAGCTCGAGCTATCAATTGAGCTAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001125.2-1798s21c1
Sequence:CCGGGAAGGGAAGAGAGCTAGTATGCTCGAGCATACTAGCTCTCTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001125.2-1755s21c1
Sequence:CCGGGATTCCAGGAAATACCGATATCTCGAGATATCGGTATTTCCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-1271s1c1
Sequence:CCGGCCCTCCAACTATGAGAAACTACTCGAGTAGTTTCTCATAGTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-1326s1c1
Sequence:CCGGCTTTATATTCTCTCGGGTCAACTCGAGTTGACCCGAGAGAATATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-1033s1c1
Sequence:CCGGCCCTGAGTCTTTCGGTGTGAACTCGAGTTCACACCGAAAGACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-913s1c1
Sequence:CCGGCATTGTCCAATCAGGCTACTTCTCGAGAAGTAGCCTGATTGGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-518s1c1
Sequence:CCGGCCTAAGTTGACTCAACTGTATCTCGAGATACAGTTGAGTCAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001125
ADPRH MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylarginine hydrolase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001125.2-1574s21c1
Sequence:CCGGGTCCTTTAGCTCAATTGATAGCTCGAGCTATCAATTGAGCTAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001125.2-1798s21c1
Sequence:CCGGGAAGGGAAGAGAGCTAGTATGCTCGAGCATACTAGCTCTCTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001125.2-1755s21c1
Sequence:CCGGGATTCCAGGAAATACCGATATCTCGAGATATCGGTATTTCCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-1271s1c1
Sequence:CCGGCCCTCCAACTATGAGAAACTACTCGAGTAGTTTCTCATAGTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-1326s1c1
Sequence:CCGGCTTTATATTCTCTCGGGTCAACTCGAGTTGACCCGAGAGAATATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-1033s1c1
Sequence:CCGGCCCTGAGTCTTTCGGTGTGAACTCGAGTTCACACCGAAAGACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-913s1c1
Sequence:CCGGCATTGTCCAATCAGGCTACTTCTCGAGAAGTAGCCTGATTGGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001125.2-518s1c1
Sequence:CCGGCCTAAGTTGACTCAACTGTATCTCGAGATACAGTTGAGTCAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007414
VALIDATED
ADPRH MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylarginine hydrolase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007414.2-346s1c1
Sequence:CCGGCAGTGATGATACCGTCATGCACTCGAGTGCATGACGGTATCATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007414.2-842s1c1
Sequence:CCGGCACTGGTCCTACTTCGAGAAACTCGAGTTTCTCGAAGTAGGACCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007414.2-2720s1c1
Sequence:CCGGCCTGATGACTAAGCATTCAAACTCGAGTTTGAATGCTTAGTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007414.2-535s1c1
Sequence:CCGGCGGCTATAGGATTCCCTTCAACTCGAGTTGAAGGGAATCCTATAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007414.2-2087s1c1
Sequence:CCGGGCAGAAGAGAAAGCATACAATCTCGAGATTGTATGCTTTCTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007414.2-2437s1c1
Sequence:CCGGGCATCTATGTTACTTACTGTTCTCGAGAACAGTAAGTAACATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007414.2-832s1c1
Sequence:CCGGGAATCTTCAACACTGGTCCTACTCGAGTAGGACCAGTGTTGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007414
VALIDATED
ADPRH MISSION shRNA shRNA Plasmid DNA
ADP-ribosylarginine hydrolase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007414.2-346s1c1
Sequence:CCGGCAGTGATGATACCGTCATGCACTCGAGTGCATGACGGTATCATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007414.2-842s1c1
Sequence:CCGGCACTGGTCCTACTTCGAGAAACTCGAGTTTCTCGAAGTAGGACCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007414.2-2720s1c1
Sequence:CCGGCCTGATGACTAAGCATTCAAACTCGAGTTTGAATGCTTAGTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007414.2-535s1c1
Sequence:CCGGCGGCTATAGGATTCCCTTCAACTCGAGTTGAAGGGAATCCTATAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007414.2-2087s1c1
Sequence:CCGGGCAGAAGAGAAAGCATACAATCTCGAGATTGTATGCTTTCTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007414.2-2437s1c1
Sequence:CCGGGCATCTATGTTACTTACTGTTCTCGAGAACAGTAAGTAACATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007414.2-832s1c1
Sequence:CCGGGAATCTTCAACACTGGTCCTACTCGAGTAGGACCAGTGTTGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007414
VALIDATED
ADPRH MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylarginine hydrolase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007414.2-346s1c1
Sequence:CCGGCAGTGATGATACCGTCATGCACTCGAGTGCATGACGGTATCATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007414.2-842s1c1
Sequence:CCGGCACTGGTCCTACTTCGAGAAACTCGAGTTTCTCGAAGTAGGACCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007414.2-2720s1c1
Sequence:CCGGCCTGATGACTAAGCATTCAAACTCGAGTTTGAATGCTTAGTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007414.2-535s1c1
Sequence:CCGGCGGCTATAGGATTCCCTTCAACTCGAGTTGAAGGGAATCCTATAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007414.2-2087s1c1
Sequence:CCGGGCAGAAGAGAAAGCATACAATCTCGAGATTGTATGCTTTCTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007414.2-2437s1c1
Sequence:CCGGGCATCTATGTTACTTACTGTTCTCGAGAACAGTAAGTAACATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007414.2-832s1c1
Sequence:CCGGGAATCTTCAACACTGGTCCTACTCGAGTAGGACCAGTGTTGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks