EMAIL THIS PAGE TO A FRIEND

ADPRHL1

ADP-ribosylhydrolase like 1

57 Gene Product Result for
Synonyms: ARH2
UniProtKB ID: Q8NDY3, Q5JUG2, Q96GD1
Gene ID:
Human(113622) Summary: ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]
Mouse(234072) ADP-ribosylhydrolase like 1
Rat(290880) ADP-ribosylhydrolase like 1
domestic guinea pig(100734474) ADP-ribosylhydrolase like 1
naked mole-rat(101699986) ADP-ribosylhydrolase like 1
sheep(101119915) ADP-ribosylhydrolase like 1
Domestic Rabbit(100353493) ADP-ribosylhydrolase like 1
Zebrafish(450012) ADP-ribosylhydrolase like 1
chicken(418741) ADP-ribosylhydrolase like 1
domestic cat(101091336) ADP-ribosylhydrolase like 1
cow(519627) ADP-ribosylhydrolase like 1
dog(100688150) ADP-ribosylhydrolase like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138430 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138430 Rosetta Predictions human pricing
NM_199162 Rosetta Predictions human pricing
NM_001013054 Rosetta Predictions rat pricing
NM_172750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157161 predicted 1292
2 SASI_Hs02_00363583 predicted 1320
3 SASI_Hs01_00157162 predicted 959
4 SASI_Hs01_00157163 predicted 1252
5 SASI_Hs01_00157164 predicted 748
6 SASI_Hs01_00157165 predicted 963
7 SASI_Hs01_00157166 predicted 1365
8 SASI_Hs01_00157168 predicted 1274
9 SASI_Hs01_00157169 predicted 699
10 SASI_Hs01_00157170 predicted 1271
11 SASI_Hs01_00157167 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204718 predicted 1144
2 SASI_Hs01_00204719 predicted 809
3 SASI_Hs02_00372593 predicted 1097
4 SASI_Hs01_00204720 predicted 594
5 SASI_Hs01_00204721 predicted 805
6 SASI_Hs01_00204722 predicted 1210
7 SASI_Hs01_00204724 predicted 1117
8 SASI_Hs01_00204725 predicted 863
9 SASI_Hs01_00204726 predicted 544
10 SASI_Hs01_00204727 predicted 1109
11 SASI_Hs01_00204723 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114480 predicted 267
2 SASI_Rn01_00114481 predicted 653
3 SASI_Rn01_00114482 predicted 1207
4 SASI_Rn01_00114483 predicted 1199
5 SASI_Rn01_00114484 predicted 199
6 SASI_Rn01_00114485 predicted 492
7 SASI_Rn01_00114486 predicted 568
8 SASI_Rn01_00114487 predicted 1043
9 SASI_Rn01_00114488 predicted 429
10 SASI_Rn02_00200669 predicted 1090
11 SASI_Rn01_00114479 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048443 predicted 673
2 SASI_Mm01_00048444 predicted 858
3 SASI_Mm01_00048445 predicted 339
4 SASI_Mm01_00048446 predicted 367
5 SASI_Mm01_00048447 predicted 772
6 SASI_Mm01_00048448 predicted 482
7 SASI_Mm02_00344589 predicted 290
8 SASI_Mm01_00048449 predicted 574
9 SASI_Mm01_00048450 predicted 661
10 SASI_Mm01_00048451 predicted 264
11 SASI_Mm01_00048452 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138430
VALIDATED
ADPRHL1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylhydrolase like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138430.3-249s1c1
Sequence:CCGGCGTGAGTGACAACACCATCATCTCGAGATGATGGTGTTGTCACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138430.3-829s1c1
Sequence:CCGGCCCGACAATTATGATGCAGAACTCGAGTTCTGCATCATAATTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138430.3-128s1c1
Sequence:CCGGGCGATGCTCTTGGCTACAGAACTCGAGTTCTGTAGCCAAGAGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138430.3-733s1c1
Sequence:CCGGGAATACCAGGAGCACTGGTTTCTCGAGAAACCAGTGCTCCTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138430.3-407s1c1
Sequence:CCGGGTGCTCAGCTAAAGCCCAATACTCGAGTATTGGGCTTTAGCTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138430.3-336s21c1
Sequence:CCGGGGTGAGATGCTATGTGGAAATCTCGAGATTTCCACATAGCATCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138430.3-1302s21c1
Sequence:CCGGGAATCCTAACTGTTGCATAAACTCGAGTTTATGCAACAGTTAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138430.3-1368s21c1
Sequence:CCGGACATTGACACTGCGTAGATTTCTCGAGAAATCTACGCAGTGTCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138430.3-1327s21c1
Sequence:CCGGATTGTTTGTCCTGCGAGAATACTCGAGTATTCTCGCAGGACAAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138430.3-1056s21c1
Sequence:CCGGCCTCGTTCCCAAAGGCTTGTACTCGAGTACAAGCCTTTGGGAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138430
VALIDATED
ADPRHL1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylhydrolase like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138430.3-249s1c1
Sequence:CCGGCGTGAGTGACAACACCATCATCTCGAGATGATGGTGTTGTCACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138430.3-829s1c1
Sequence:CCGGCCCGACAATTATGATGCAGAACTCGAGTTCTGCATCATAATTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138430.3-128s1c1
Sequence:CCGGGCGATGCTCTTGGCTACAGAACTCGAGTTCTGTAGCCAAGAGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138430.3-733s1c1
Sequence:CCGGGAATACCAGGAGCACTGGTTTCTCGAGAAACCAGTGCTCCTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138430.3-407s1c1
Sequence:CCGGGTGCTCAGCTAAAGCCCAATACTCGAGTATTGGGCTTTAGCTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138430.3-336s21c1
Sequence:CCGGGGTGAGATGCTATGTGGAAATCTCGAGATTTCCACATAGCATCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138430.3-1302s21c1
Sequence:CCGGGAATCCTAACTGTTGCATAAACTCGAGTTTATGCAACAGTTAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138430.3-1368s21c1
Sequence:CCGGACATTGACACTGCGTAGATTTCTCGAGAAATCTACGCAGTGTCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138430.3-1327s21c1
Sequence:CCGGATTGTTTGTCCTGCGAGAATACTCGAGTATTCTCGCAGGACAAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138430.3-1056s21c1
Sequence:CCGGCCTCGTTCCCAAAGGCTTGTACTCGAGTACAAGCCTTTGGGAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138430
VALIDATED
ADPRHL1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylhydrolase like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138430.3-249s1c1
Sequence:CCGGCGTGAGTGACAACACCATCATCTCGAGATGATGGTGTTGTCACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138430.3-829s1c1
Sequence:CCGGCCCGACAATTATGATGCAGAACTCGAGTTCTGCATCATAATTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138430.3-128s1c1
Sequence:CCGGGCGATGCTCTTGGCTACAGAACTCGAGTTCTGTAGCCAAGAGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138430.3-733s1c1
Sequence:CCGGGAATACCAGGAGCACTGGTTTCTCGAGAAACCAGTGCTCCTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138430.3-407s1c1
Sequence:CCGGGTGCTCAGCTAAAGCCCAATACTCGAGTATTGGGCTTTAGCTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138430.3-336s21c1
Sequence:CCGGGGTGAGATGCTATGTGGAAATCTCGAGATTTCCACATAGCATCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138430.3-1302s21c1
Sequence:CCGGGAATCCTAACTGTTGCATAAACTCGAGTTTATGCAACAGTTAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138430.3-1368s21c1
Sequence:CCGGACATTGACACTGCGTAGATTTCTCGAGAAATCTACGCAGTGTCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138430.3-1327s21c1
Sequence:CCGGATTGTTTGTCCTGCGAGAATACTCGAGTATTCTCGCAGGACAAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138430.3-1056s21c1
Sequence:CCGGCCTCGTTCCCAAAGGCTTGTACTCGAGTACAAGCCTTTGGGAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172750
ADPRHL1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylhydrolase like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-769s1c1
Sequence:CCGGCACATGGCAGAGTACCAAGAACTCGAGTTCTTGGTACTCTGCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-462s1c1
Sequence:CCGGGAAACCGGATAACTACCTCCTCTCGAGAGGAGGTAGTTATCCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-1132s1c1
Sequence:CCGGGAACACAAAGGCAGACTAGAACTCGAGTTCTAGTCTGCCTTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-897s1c1
Sequence:CCGGGAGAGACAAGACCTACAAGAACTCGAGTTCTTGTAGGTCTTGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-856s1c1
Sequence:CCGGGAAGACAAAGTCACCTTTCCTCTCGAGAGGAAAGGTGACTTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-657s21c1
Sequence:CCGGACAGCACTGTTTGCCTCTTACCTCGAGGTAAGAGGCAAACAGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-733s21c1
Sequence:CCGGCTCTGGCTGAGGAGTACTGTACTCGAGTACAGTACTCCTCAGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-583s21c1
Sequence:CCGGCGCTCATCGAAGTCAGTATTGCTCGAGCAATACTGACTTCGATGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-533s21c1
Sequence:CCGGCAAAGCGATGTGCATCGGAATCTCGAGATTCCGATGCACATCGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172750
ADPRHL1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylhydrolase like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-769s1c1
Sequence:CCGGCACATGGCAGAGTACCAAGAACTCGAGTTCTTGGTACTCTGCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-462s1c1
Sequence:CCGGGAAACCGGATAACTACCTCCTCTCGAGAGGAGGTAGTTATCCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-1132s1c1
Sequence:CCGGGAACACAAAGGCAGACTAGAACTCGAGTTCTAGTCTGCCTTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-897s1c1
Sequence:CCGGGAGAGACAAGACCTACAAGAACTCGAGTTCTTGTAGGTCTTGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-856s1c1
Sequence:CCGGGAAGACAAAGTCACCTTTCCTCTCGAGAGGAAAGGTGACTTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-657s21c1
Sequence:CCGGACAGCACTGTTTGCCTCTTACCTCGAGGTAAGAGGCAAACAGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-733s21c1
Sequence:CCGGCTCTGGCTGAGGAGTACTGTACTCGAGTACAGTACTCCTCAGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-583s21c1
Sequence:CCGGCGCTCATCGAAGTCAGTATTGCTCGAGCAATACTGACTTCGATGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-533s21c1
Sequence:CCGGCAAAGCGATGTGCATCGGAATCTCGAGATTCCGATGCACATCGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172750
ADPRHL1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylhydrolase like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-769s1c1
Sequence:CCGGCACATGGCAGAGTACCAAGAACTCGAGTTCTTGGTACTCTGCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-462s1c1
Sequence:CCGGGAAACCGGATAACTACCTCCTCTCGAGAGGAGGTAGTTATCCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-1132s1c1
Sequence:CCGGGAACACAAAGGCAGACTAGAACTCGAGTTCTAGTCTGCCTTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-897s1c1
Sequence:CCGGGAGAGACAAGACCTACAAGAACTCGAGTTCTTGTAGGTCTTGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172750.1-856s1c1
Sequence:CCGGGAAGACAAAGTCACCTTTCCTCTCGAGAGGAAAGGTGACTTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-657s21c1
Sequence:CCGGACAGCACTGTTTGCCTCTTACCTCGAGGTAAGAGGCAAACAGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-733s21c1
Sequence:CCGGCTCTGGCTGAGGAGTACTGTACTCGAGTACAGTACTCCTCAGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-583s21c1
Sequence:CCGGCGCTCATCGAAGTCAGTATTGCTCGAGCAATACTGACTTCGATGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172750.3-533s21c1
Sequence:CCGGCAAAGCGATGTGCATCGGAATCTCGAGATTCCGATGCACATCGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks