EMAIL THIS PAGE TO A FRIEND

ADPRHL2

ADP-ribosylhydrolase like 2

51 Gene Product Result for
Synonyms: ARH3
UniProtKB ID: Q9NX46, Q53G94, Q6IAB8, Q9BY47
Gene ID:
Human(54936) Summary: This gene encodes a member of the ADP-ribosylglycohydrolase family. The encoded enzyme catalyzes the removal of ADP-ribose from ADP-ribosylated proteins. This enzyme localizes to the mitochondria, in addition to the nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Mouse(100206) ADP-ribosylhydrolase like 2
Rat(362600) ADP-ribosylhydrolase like 2
Zebrafish(796446) ADP-ribosylhydrolase like 2
chicken(419626) ADP-ribosylhydrolase like 2
cow(521650) ADP-ribosylhydrolase like 2
domestic cat(101086825) ADP-ribosylhydrolase like 2
dog(608601) ADP-ribosylhydrolase like 2
sheep(101116791) ADP-ribosylhydrolase like 2
naked mole-rat(101717767) ADP-ribosylhydrolase like 2
domestic guinea pig(100732391) ADP-ribosylhydrolase like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017825 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017825 Rosetta Predictions human pricing
NM_001108680 Rosetta Predictions rat pricing
NM_133883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198856 predicted 318
2 SASI_Hs01_00198857 predicted 917
3 SASI_Hs01_00198858 predicted 720
4 SASI_Hs02_00350698 predicted 404
5 SASI_Hs01_00198859 predicted 894
6 SASI_Hs01_00198860 predicted 752
7 SASI_Hs01_00198861 predicted 1401
8 SASI_Hs01_00198862 predicted 989
9 SASI_Hs01_00198864 predicted 220
10 SASI_Hs01_00198865 predicted 305
11 SASI_Hs01_00198863 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241015 predicted 722
2 SASI_Rn02_00241016 predicted 538
3 SASI_Rn02_00241017 predicted 1017
4 SASI_Rn02_00241018 predicted 829
5 SASI_Rn02_00241019 predicted 1061
6 SASI_Rn02_00241020 predicted 356
7 SASI_Rn02_00241021 predicted 954
8 SASI_Rn02_00241022 predicted 1187
9 SASI_Rn02_00241023 predicted 771
10 SASI_Rn02_00241024 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115158 predicted 439
2 SASI_Mm01_00115159 predicted 542
3 SASI_Mm01_00115160 predicted 591
4 SASI_Mm01_00115161 predicted 539
5 SASI_Mm01_00115163 predicted 1019
6 SASI_Mm02_00338939 predicted 535
7 SASI_Mm01_00115164 predicted 851
8 SASI_Mm01_00115165 predicted 1027
9 SASI_Mm01_00115166 predicted 956
10 SASI_Mm02_00338940 predicted 750
11 SASI_Mm01_00115162 predicted 727
12 SASI_Mm01_00115167 predicted 829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133883
VALIDATED
ADPRHL2 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylhydrolase like 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-1022s21c1
Sequence:CCGGCCATTGCTGGAGCTTACTATGCTCGAGCATAGTAAGCTCCAGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-405s21c1
Sequence:CCGGCGGAGTCATCACTGTCTTCAACTCGAGTTGAAGACAGTGATGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-1071s21c1
Sequence:CCGGGCAAAGTTGTGAAGGCTTTGACTCGAGTCAAAGCCTTCACAACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-1183s21c1
Sequence:CCGGGACCAAGGACAACTCAGATTGCTCGAGCAATCTGAGTTGTCCTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133883.1-957s1c1
Sequence:CCGGGAGGACTCTCATCTACTCCATCTCGAGATGGAGTAGATGAGAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133883.1-262s1c1
Sequence:CCGGGAGACACTGTACTACACAGATCTCGAGATCTGTGTAGTACAGTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-405s1c1
Sequence:CCGGCGGAGTCATCACTGTCTTCAACTCGAGTTGAAGACAGTGATGACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-367s1c1
Sequence:CCGGCAGGAATACAAGAAGGACCCTCTCGAGAGGGTCCTTCTTGTATTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-1069s1c1
Sequence:CCGGCAGCAAAGTTGTGAAGGCTTTCTCGAGAAAGCCTTCACAACTTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-964s1c1
Sequence:CCGGCTCATCTACTCCATCTCACTTCTCGAGAAGTGAGATGGAGTAGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133883.1-1071s1c1
Sequence:CCGGGCAAAGTTGTGAAGGCTTTGACTCGAGTCAAAGCCTTCACAACTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133883
VALIDATED
ADPRHL2 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylhydrolase like 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-1022s21c1
Sequence:CCGGCCATTGCTGGAGCTTACTATGCTCGAGCATAGTAAGCTCCAGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-405s21c1
Sequence:CCGGCGGAGTCATCACTGTCTTCAACTCGAGTTGAAGACAGTGATGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-1071s21c1
Sequence:CCGGGCAAAGTTGTGAAGGCTTTGACTCGAGTCAAAGCCTTCACAACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-1183s21c1
Sequence:CCGGGACCAAGGACAACTCAGATTGCTCGAGCAATCTGAGTTGTCCTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133883.1-957s1c1
Sequence:CCGGGAGGACTCTCATCTACTCCATCTCGAGATGGAGTAGATGAGAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133883.1-262s1c1
Sequence:CCGGGAGACACTGTACTACACAGATCTCGAGATCTGTGTAGTACAGTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-405s1c1
Sequence:CCGGCGGAGTCATCACTGTCTTCAACTCGAGTTGAAGACAGTGATGACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-367s1c1
Sequence:CCGGCAGGAATACAAGAAGGACCCTCTCGAGAGGGTCCTTCTTGTATTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-1069s1c1
Sequence:CCGGCAGCAAAGTTGTGAAGGCTTTCTCGAGAAAGCCTTCACAACTTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-964s1c1
Sequence:CCGGCTCATCTACTCCATCTCACTTCTCGAGAAGTGAGATGGAGTAGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133883.1-1071s1c1
Sequence:CCGGGCAAAGTTGTGAAGGCTTTGACTCGAGTCAAAGCCTTCACAACTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133883
VALIDATED
ADPRHL2 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylhydrolase like 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-1022s21c1
Sequence:CCGGCCATTGCTGGAGCTTACTATGCTCGAGCATAGTAAGCTCCAGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-405s21c1
Sequence:CCGGCGGAGTCATCACTGTCTTCAACTCGAGTTGAAGACAGTGATGACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-1071s21c1
Sequence:CCGGGCAAAGTTGTGAAGGCTTTGACTCGAGTCAAAGCCTTCACAACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133883.2-1183s21c1
Sequence:CCGGGACCAAGGACAACTCAGATTGCTCGAGCAATCTGAGTTGTCCTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133883.1-957s1c1
Sequence:CCGGGAGGACTCTCATCTACTCCATCTCGAGATGGAGTAGATGAGAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133883.1-262s1c1
Sequence:CCGGGAGACACTGTACTACACAGATCTCGAGATCTGTGTAGTACAGTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-405s1c1
Sequence:CCGGCGGAGTCATCACTGTCTTCAACTCGAGTTGAAGACAGTGATGACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-367s1c1
Sequence:CCGGCAGGAATACAAGAAGGACCCTCTCGAGAGGGTCCTTCTTGTATTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-1069s1c1
Sequence:CCGGCAGCAAAGTTGTGAAGGCTTTCTCGAGAAAGCCTTCACAACTTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133883.1-964s1c1
Sequence:CCGGCTCATCTACTCCATCTCACTTCTCGAGAAGTGAGATGGAGTAGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133883.1-1071s1c1
Sequence:CCGGGCAAAGTTGTGAAGGCTTTGACTCGAGTCAAAGCCTTCACAACTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017825
VALIDATED
ADPRHL2 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylhydrolase like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017825.1-756s1c1
Sequence:CCGGCTGAAGAAGATTGGAGAGCTTCTCGAGAAGCTCTCCAATCTTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017825.1-907s1c1
Sequence:CCGGCTGCCTTCAATAGCCTCCAAACTCGAGTTTGGAGGCTATTGAAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_017825.1-231s1c1
Sequence:CCGGGAAGCCTTGTACTACACAGATCTCGAGATCTGTGTAGTACAAGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017825.1-919s1c1
Sequence:CCGGGCCTCCAAAGGACTCTCATTTCTCGAGAAATGAGAGTCCTTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017825.1-1458s1c1
Sequence:CCGGGTAGCATCATTTCTCCCTGTTCTCGAGAACAGGGAGAAATGATGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017825
VALIDATED
ADPRHL2 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylhydrolase like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017825.1-756s1c1
Sequence:CCGGCTGAAGAAGATTGGAGAGCTTCTCGAGAAGCTCTCCAATCTTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017825.1-907s1c1
Sequence:CCGGCTGCCTTCAATAGCCTCCAAACTCGAGTTTGGAGGCTATTGAAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_017825.1-231s1c1
Sequence:CCGGGAAGCCTTGTACTACACAGATCTCGAGATCTGTGTAGTACAAGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017825.1-919s1c1
Sequence:CCGGGCCTCCAAAGGACTCTCATTTCTCGAGAAATGAGAGTCCTTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017825.1-1458s1c1
Sequence:CCGGGTAGCATCATTTCTCCCTGTTCTCGAGAACAGGGAGAAATGATGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017825
VALIDATED
ADPRHL2 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylhydrolase like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017825.1-756s1c1
Sequence:CCGGCTGAAGAAGATTGGAGAGCTTCTCGAGAAGCTCTCCAATCTTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017825.1-907s1c1
Sequence:CCGGCTGCCTTCAATAGCCTCCAAACTCGAGTTTGGAGGCTATTGAAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_017825.1-231s1c1
Sequence:CCGGGAAGCCTTGTACTACACAGATCTCGAGATCTGTGTAGTACAAGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017825.1-919s1c1
Sequence:CCGGGCCTCCAAAGGACTCTCATTTCTCGAGAAATGAGAGTCCTTTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017825.1-1458s1c1
Sequence:CCGGGTAGCATCATTTCTCCCTGTTCTCGAGAACAGGGAGAAATGATGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)