EMAIL THIS PAGE TO A FRIEND

ADPRM

ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent

47 Gene Product Result for
Synonyms: C17orf48 NBLA03831
UniProtKB ID: Q3LIE5, A8K9B4, D3DTS4, Q9BVD4, Q9NRU8
Gene ID:
Mouse(66358) ADP-ribose/CDP-alcohol diphosphatase, manganese dependent
Rat(287406) ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
naked mole-rat(101700336) ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
sheep(101113772) ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
Zebrafish(393393) ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
cow(534038) ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
domestic cat(101085161) ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
dog(479504) ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020233 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034901 MISSION® esiRNA esiRNA human C17orf48 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020233 Rosetta Predictions human pricing
NM_001009246 Rosetta Predictions rat pricing
NM_025510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199575 predicted 531
2 SASI_Hs01_00199576 predicted 536
3 SASI_Hs01_00199577 predicted 860
4 SASI_Hs01_00199578 predicted 746
5 SASI_Hs01_00199579 predicted 314
6 SASI_Hs01_00199580 predicted 226
7 SASI_Hs01_00199581 predicted 573
8 SASI_Hs01_00199582 predicted 363
9 SASI_Hs01_00199583 predicted 624
10 SASI_Hs02_00353188 predicted 299
11 SASI_Hs01_00199574 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111111 predicted 240
2 SASI_Rn01_00111112 predicted 609
3 SASI_Rn01_00111113 predicted 393
4 SASI_Rn01_00111114 predicted 383
5 SASI_Rn02_00199501 predicted 502
6 SASI_Rn01_00111116 predicted 940
7 SASI_Rn01_00111117 predicted 503
8 SASI_Rn01_00111118 predicted 771
9 SASI_Rn01_00111119 predicted 238
10 SASI_Rn01_00111120 predicted 223
11 SASI_Rn01_00111115 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051629 predicted 560
2 SASI_Mm01_00051630 predicted 271
3 SASI_Mm02_00328396 predicted 1215
4 SASI_Mm01_00051631 predicted 647
5 SASI_Mm01_00051632 predicted 718
6 SASI_Mm02_00328397 predicted 365
7 SASI_Mm02_00328398 predicted 990
8 SASI_Mm01_00051635 predicted 354
9 SASI_Mm01_00051636 predicted 477
10 SASI_Mm01_00051637 predicted 302
11 SASI_Mm01_00051633 predicted 484
12 SASI_Mm01_00051634 predicted 860
13 SASI_Mm01_00051638 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025510
VALIDATED
ADPRM MISSION shRNA Bacterial Glycerol Stock
ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025510.1-1304s1c1
Sequence:CCGGCCTCATTATCTTGTCTGCTTTCTCGAGAAAGCAGACAAGATAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025510.1-782s1c1
Sequence:CCGGCCCAAGGTGAATTATTGCTTTCTCGAGAAAGCAATAATTCACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025510.1-427s1c1
Sequence:CCGGGCACAGTATAAAGTATCAGAACTCGAGTTCTGATACTTTATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025510.1-243s1c1
Sequence:CCGGCTTCGGAGTTATAGCAGATATCTCGAGATATCTGCTATAACTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025510.1-270s1c1
Sequence:CCGGCGCAGATTTAGAAGATGGATACTCGAGTATCCATCTTCTAAATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-267s21c1
Sequence:CCGGTCGGAGTTATAGCAGATATTCCTCGAGGAATATCTGCTATAACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-672s21c1
Sequence:CCGGTCCCTAAGTTCCGGTTCATTTCTCGAGAAATGAACCGGAACTTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-645s21c1
Sequence:CCGGACTATTACGCTTATCACTTTGCTCGAGCAAAGTGATAAGCGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-1088s21c1
Sequence:CCGGGTCAACCTTGAAGGAGTTATTCTCGAGAATAACTCCTTCAAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025510.3-1317s21c1
Sequence:CCGGCAGTTGTACTCTTAAGTATTCCTCGAGGAATACTTAAGAGTACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025510
VALIDATED
ADPRM MISSION shRNA shRNA Plasmid DNA
ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025510.1-1304s1c1
Sequence:CCGGCCTCATTATCTTGTCTGCTTTCTCGAGAAAGCAGACAAGATAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025510.1-782s1c1
Sequence:CCGGCCCAAGGTGAATTATTGCTTTCTCGAGAAAGCAATAATTCACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025510.1-427s1c1
Sequence:CCGGGCACAGTATAAAGTATCAGAACTCGAGTTCTGATACTTTATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025510.1-243s1c1
Sequence:CCGGCTTCGGAGTTATAGCAGATATCTCGAGATATCTGCTATAACTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025510.1-270s1c1
Sequence:CCGGCGCAGATTTAGAAGATGGATACTCGAGTATCCATCTTCTAAATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-267s21c1
Sequence:CCGGTCGGAGTTATAGCAGATATTCCTCGAGGAATATCTGCTATAACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-672s21c1
Sequence:CCGGTCCCTAAGTTCCGGTTCATTTCTCGAGAAATGAACCGGAACTTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-645s21c1
Sequence:CCGGACTATTACGCTTATCACTTTGCTCGAGCAAAGTGATAAGCGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-1088s21c1
Sequence:CCGGGTCAACCTTGAAGGAGTTATTCTCGAGAATAACTCCTTCAAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025510.3-1317s21c1
Sequence:CCGGCAGTTGTACTCTTAAGTATTCCTCGAGGAATACTTAAGAGTACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025510
VALIDATED
ADPRM MISSION shRNA Lentiviral Transduction Particles
ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025510.1-1304s1c1
Sequence:CCGGCCTCATTATCTTGTCTGCTTTCTCGAGAAAGCAGACAAGATAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025510.1-782s1c1
Sequence:CCGGCCCAAGGTGAATTATTGCTTTCTCGAGAAAGCAATAATTCACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025510.1-427s1c1
Sequence:CCGGGCACAGTATAAAGTATCAGAACTCGAGTTCTGATACTTTATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025510.1-243s1c1
Sequence:CCGGCTTCGGAGTTATAGCAGATATCTCGAGATATCTGCTATAACTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025510.1-270s1c1
Sequence:CCGGCGCAGATTTAGAAGATGGATACTCGAGTATCCATCTTCTAAATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-267s21c1
Sequence:CCGGTCGGAGTTATAGCAGATATTCCTCGAGGAATATCTGCTATAACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-672s21c1
Sequence:CCGGTCCCTAAGTTCCGGTTCATTTCTCGAGAAATGAACCGGAACTTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-645s21c1
Sequence:CCGGACTATTACGCTTATCACTTTGCTCGAGCAAAGTGATAAGCGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025510.3-1088s21c1
Sequence:CCGGGTCAACCTTGAAGGAGTTATTCTCGAGAATAACTCCTTCAAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025510.3-1317s21c1
Sequence:CCGGCAGTTGTACTCTTAAGTATTCCTCGAGGAATACTTAAGAGTACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020233
VALIDATED
ADPRM MISSION shRNA Bacterial Glycerol Stock
ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020233.3-793s1c1
Sequence:CCGGGCTAACATTCTCTGACACAAACTCGAGTTTGTGTCAGAGAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020233.3-570s1c1
Sequence:CCGGCGAGCAGTGTATGAAGATATTCTCGAGAATATCTTCATACACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020233.3-271s1c1
Sequence:CCGGGCACAGTATAATGCATCCAAACTCGAGTTTGGATGCATTATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020233.3-453s1c1
Sequence:CCGGCATGCCTTCAGAAGATTATTACTCGAGTAATAATCTTCTGAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020233.3-452s1c1
Sequence:CCGGCCATGCCTTCAGAAGATTATTCTCGAGAATAATCTTCTGAAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020233.4-497s21c1
Sequence:CCGGCCATGCCTTCAGAAGATTATTCTCGAGAATAATCTTCTGAAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020233.4-955s21c1
Sequence:CCGGGTCAACCTAGAAGGAGTTATTCTCGAGAATAACTCCTTCTAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020233.4-539s21c1
Sequence:CCGGTCCCTAAATTCCGGTTCATTTCTCGAGAAATGAACCGGAATTTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020233.4-1092s21c1
Sequence:CCGGCTTCCATTGTTAGTCTAATTTCTCGAGAAATTAGACTAACAATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020233.4-1268s21c1
Sequence:CCGGGGATCATGTATCCATTGTAAGCTCGAGCTTACAATGGATACATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020233
VALIDATED
ADPRM MISSION shRNA shRNA Plasmid DNA
ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020233.3-793s1c1
Sequence:CCGGGCTAACATTCTCTGACACAAACTCGAGTTTGTGTCAGAGAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020233.3-570s1c1
Sequence:CCGGCGAGCAGTGTATGAAGATATTCTCGAGAATATCTTCATACACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020233.3-271s1c1
Sequence:CCGGGCACAGTATAATGCATCCAAACTCGAGTTTGGATGCATTATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020233.3-453s1c1
Sequence:CCGGCATGCCTTCAGAAGATTATTACTCGAGTAATAATCTTCTGAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020233.3-452s1c1
Sequence:CCGGCCATGCCTTCAGAAGATTATTCTCGAGAATAATCTTCTGAAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020233.4-497s21c1
Sequence:CCGGCCATGCCTTCAGAAGATTATTCTCGAGAATAATCTTCTGAAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020233.4-955s21c1
Sequence:CCGGGTCAACCTAGAAGGAGTTATTCTCGAGAATAACTCCTTCTAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020233.4-539s21c1
Sequence:CCGGTCCCTAAATTCCGGTTCATTTCTCGAGAAATGAACCGGAATTTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020233.4-1092s21c1
Sequence:CCGGCTTCCATTGTTAGTCTAATTTCTCGAGAAATTAGACTAACAATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020233.4-1268s21c1
Sequence:CCGGGGATCATGTATCCATTGTAAGCTCGAGCTTACAATGGATACATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020233
VALIDATED
ADPRM MISSION shRNA Lentiviral Transduction Particles
ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020233.3-793s1c1
Sequence:CCGGGCTAACATTCTCTGACACAAACTCGAGTTTGTGTCAGAGAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020233.3-570s1c1
Sequence:CCGGCGAGCAGTGTATGAAGATATTCTCGAGAATATCTTCATACACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020233.3-271s1c1
Sequence:CCGGGCACAGTATAATGCATCCAAACTCGAGTTTGGATGCATTATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020233.3-453s1c1
Sequence:CCGGCATGCCTTCAGAAGATTATTACTCGAGTAATAATCTTCTGAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020233.3-452s1c1
Sequence:CCGGCCATGCCTTCAGAAGATTATTCTCGAGAATAATCTTCTGAAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020233.4-497s21c1
Sequence:CCGGCCATGCCTTCAGAAGATTATTCTCGAGAATAATCTTCTGAAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020233.4-955s21c1
Sequence:CCGGGTCAACCTAGAAGGAGTTATTCTCGAGAATAACTCCTTCTAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020233.4-539s21c1
Sequence:CCGGTCCCTAAATTCCGGTTCATTTCTCGAGAAATGAACCGGAATTTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020233.4-1092s21c1
Sequence:CCGGCTTCCATTGTTAGTCTAATTTCTCGAGAAATTAGACTAACAATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020233.4-1268s21c1
Sequence:CCGGGGATCATGTATCCATTGTAAGCTCGAGCTTACAATGGATACATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks