EMAIL THIS PAGE TO A FRIEND

ADRA1A

adrenoceptor alpha 1A

208 Gene Product Result for
Synonyms: ADRA1C ADRA1L1 ALPHA1AAR
Gene ID:
Human(148) Summary: Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1A-adrenergic receptor. Alternative splicing of this gene generates four transcript variants, which encode four different isoforms with distinct C-termini but having similar ligand binding properties. [provided by RefSeq, Jul 2008]
Mouse(11549) adrenergic receptor, alpha 1a
Rat(29412) adrenoceptor alpha 1A
chicken(428203) adrenoceptor alpha 1A
cow(282134) adrenergic, alpha-1A-, receptor
domestic cat(101098375) adrenoceptor alpha 1A
dog(403866) adrenoceptor alpha 1A
sheep(100169940) adrenoceptor alpha 1A
Domestic Rabbit(100009237) adrenoceptor alpha 1A
naked mole-rat(101712485) adrenoceptor alpha 1A
domestic guinea pig(100135474) adrenergic receptor, alpha 1a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A270 Anti-α1 Adrenergic Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, western blot pricing
A4604 Anti-α1C Adrenergic Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2502161 Anti-ADRA1A (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA029679 Anti-ADRA1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA029678 Anti-ADRA1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500530 Anti-ADRA1A antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence pricing
SAB4500529 Anti-ADRA1A, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
WH0000148M1 Monoclonal Anti-ADRA1A antibody produced in mouse clone 4C7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403528 Monoclonal Anti-ADRA1A, (N-terminal) antibody produced in mouse clone 5G8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
V4629 (±)-Verapamil hydrochloride ≥99% (titration), powder human pricing
U101 5-Methylurapidil solid human pricing
B016 Benoxathian hydrochloride solid human pricing
D4526 Doxepin hydrochloride ~85% E-isomer basis, ≥98% (GC), 15% Z-isomer basis, powder human pricing
E3263 Efaroxan hydrochloride ≥98% (HPLC) human pricing
F6145 Fenspiride hydrochloride analytical standard, for drug analysis human pricing
F4303 Fiduxosin hydrochloride >98% (HPLC), solid human pricing
M5154 Moxisylyte hydrochloride >99% (TLC), powder human pricing
N158 Naftopidil hydrochloride hydrate solid human pricing
P6402 Perphenazine human pricing
B019 Phenoxybenzamine hydrochloride ≥97%, powder human pricing
P7561 Phentolamine methanesulfonate salt ≥98% (TLC), powder human pricing
P7791 Prazosin hydrochloride ≥99% (TLC) human pricing
T4680 Terazosin hydrochloride ≥98% (TLC), powder human pricing
U104 UK 14,304 human pricing
U100 Urapidil hydrochloride solid human pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
M0443 Mirtazapine ≥98% (HPLC) human, mouse, rat pricing
T5625 (±)-α-Lipoic acid synthetic, ≥99% (titration), powder human, rat pricing
T1395 (±)-α-Lipoic acid BioReagent, cell culture tested, ≥99% human, rat pricing
62320 (±)-α-Lipoic acid ≥98.0% human, rat pricing
A7257 (−)-Norepinephrine ≥98%, crystalline human, rat pricing
S7771 (S)-(−)-Sulpiride ≥98% (titration) human, rat pricing
34002 (S)-(−)-Sulpiride VETRANAL, analytical standard human, rat pricing
B9308 BP897 >98% (HPLC), solid human, rat pricing
C6305 Clozapine human, rat pricing
D9815 Doxazosin mesylate ≥97% (HPLC), powder human, rat pricing
E2031 Eliprodil ≥98% (HPLC), powder human, rat pricing
H1512 Haloperidol powder human, rat pricing
51330 Harmaline human, rat pricing
L3040 L-765,314 hydrate ≥98% (HPLC), solid human, rat pricing
R103 Ritanserin powder human, rat pricing
S0693 SB 204741 >98% (HPLC) human, rat pricing
S7395 Spiperone solid human, rat pricing
M22601 1-(2-Methoxyphenyl)piperazine 98% mouse, rat pricing
E1635 (±)-Epinephrine ≥95% rat pricing
E4250 (−)-Epinephrine rat pricing
282553 (1R,2S)-(−)-Norephedrine 99% rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N7889 Nicergoline analytical standard, for drug analysis human pricing
594687 α-Sexithiophene human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033303 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000680 Rosetta Predictions human pricing
NM_033302 Rosetta Predictions human pricing
NM_033303 Rosetta Predictions human pricing
NM_033304 Rosetta Predictions human pricing
NM_017191 Rosetta Predictions rat pricing
NM_013461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303073 predicted 436
2 SASI_Hs02_00303074 predicted 1319
3 SASI_Hs02_00303075 predicted 1411
4 SASI_Hs01_00047401 predicted 802
5 SASI_Hs01_00047402 predicted 575
6 SASI_Hs01_00047404 predicted 609
7 SASI_Hs02_00303076 predicted 1077
8 SASI_Hs02_00303077 predicted 1441
9 SASI_Hs01_00047405 predicted 570
10 SASI_Hs02_00303078 predicted 765
11 SASI_Hs01_00047400 predicted 1210
12 SASI_Hs01_00047403 predicted 952
13 SASI_Hs01_00047406 predicted 1195
14 SASI_Hs01_00047407 predicted 1111
15 SASI_Hs01_00047408 predicted 1190
16 SASI_Hs01_00047409 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361121 predicted 436
2 SASI_Hs02_00361122 predicted 1310
3 SASI_Hs02_00361123 predicted 1410
4 SASI_Hs01_00178896 predicted 805
5 SASI_Hs01_00178897 predicted 580
6 SASI_Hs01_00178899 predicted 617
7 SASI_Hs02_00361124 predicted 1082
8 SASI_Hs02_00361125 predicted 1439
9 SASI_Hs01_00178900 predicted 571
10 SASI_Hs02_00361126 predicted 769
11 SASI_Hs01_00178895 predicted 1206
12 SASI_Hs01_00178898 predicted 949
13 SASI_Hs01_00178901 predicted 1191
14 SASI_Hs01_00178902 predicted 1112
15 SASI_Hs01_00178903 predicted 1186
16 SASI_Hs01_00178904 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361127 predicted 436
2 SASI_Hs02_00361128 predicted 1316
3 SASI_Hs02_00361129 predicted 1406
4 SASI_Hs01_00068700 predicted 800
5 SASI_Hs01_00068701 predicted 582
6 SASI_Hs01_00068703 predicted 617
7 SASI_Hs02_00361130 predicted 1078
8 SASI_Hs02_00361131 predicted 1436
9 SASI_Hs01_00068704 predicted 573
10 SASI_Hs02_00361132 predicted 773
11 SASI_Hs01_00068699 predicted 1207
12 SASI_Hs01_00068702 predicted 952
13 SASI_Hs01_00068705 predicted 1196
14 SASI_Hs01_00068706 predicted 1111
15 SASI_Hs01_00068707 predicted 1193
16 SASI_Hs01_00068708 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361133 predicted 435
2 SASI_Hs02_00361134 predicted 1317
3 SASI_Hs02_00361135 predicted 1415
4 SASI_Hs01_00099642 predicted 798
5 SASI_Hs01_00099643 predicted 574
6 SASI_Hs01_00099645 predicted 613
7 SASI_Hs02_00361136 predicted 1085
8 SASI_Hs02_00361137 predicted 1441
9 SASI_Hs01_00099646 predicted 566
10 SASI_Hs02_00361138 predicted 769
11 SASI_Hs01_00099641 predicted 972
12 SASI_Hs01_00099644 predicted 714
13 SASI_Hs01_00099647 predicted 955
14 SASI_Hs01_00099648 predicted 866
15 SASI_Hs01_00099649 predicted 950
16 SASI_Hs01_00099650 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261538 predicted 1106
2 SASI_Rn02_00261539 predicted 671
3 SASI_Rn01_00108036 predicted 970
4 SASI_Rn01_00108038 predicted 1175
5 SASI_Rn02_00261540 predicted 1030
6 SASI_Rn02_00261541 predicted 530
7 SASI_Rn01_00108040 predicted 376
8 SASI_Rn01_00108041 predicted 761
9 SASI_Rn01_00108042 predicted 324
10 SASI_Rn02_00261542 predicted 368
11 SASI_Rn01_00108035 predicted 1264
12 SASI_Rn01_00108037 predicted 1466
13 SASI_Rn01_00108039 predicted 648
14 SASI_Rn01_00108043 predicted 921
15 SASI_Rn01_00108044 predicted 1372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194699 predicted 1675
2 SASI_Mm01_00194700 predicted 1884
3 SASI_Mm01_00194701 predicted 990
4 SASI_Mm01_00194702 predicted 1298
5 SASI_Mm01_00194703 predicted 2153
6 SASI_Mm01_00194704 predicted 1242
7 SASI_Mm01_00194705 predicted 1107
8 SASI_Mm01_00194706 predicted 2322
9 SASI_Mm01_00194707 predicted 2270
10 SASI_Mm02_00322068 predicted 1748
11 SASI_Mm01_00194708 predicted 2283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033303
ADRA1A MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 1A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033303.3-1307s21c1
Sequence:CCGGGTCATGCCCATTGGGTCTTTCCTCGAGGAAAGACCCAATGGGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033303.3-2052s21c1
Sequence:CCGGCTTGCTCAGAAGCTCAATATGCTCGAGCATATTGAGCTTCTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033303.3-1613s21c1
Sequence:CCGGGGCGTTTGTGAATGGAAATTTCTCGAGAAATTTCCATTCACAAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033303.3-1650s21c1
Sequence:CCGGGTGGATCTGCCAGGATTACAGCTCGAGCTGTAATCCTGGCAGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-1331s1c1
Sequence:CCGGCCTGATTTCAAGCCCTCTGAACTCGAGTTCAGAGGGCTTGAAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-1658s1c1
Sequence:CCGGGCCAGGATTACAGTGTCCAAACTCGAGTTTGGACACTGTAATCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-616s1c1
Sequence:CCGGCACGCACTACTACATCGTCAACTCGAGTTGACGATGTAGTAGTGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033303.1-2030s1c1
Sequence:CCGGGCAATCCTTTCTGTGGATGAACTCGAGTTCATCCACAGAAAGGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-1443s1c1
Sequence:CCGGCCTTTCAGAATGTCTTGAGAACTCGAGTTCTCAAGACATTCTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033303
ADRA1A MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 1A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033303.3-1307s21c1
Sequence:CCGGGTCATGCCCATTGGGTCTTTCCTCGAGGAAAGACCCAATGGGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033303.3-2052s21c1
Sequence:CCGGCTTGCTCAGAAGCTCAATATGCTCGAGCATATTGAGCTTCTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033303.3-1613s21c1
Sequence:CCGGGGCGTTTGTGAATGGAAATTTCTCGAGAAATTTCCATTCACAAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033303.3-1650s21c1
Sequence:CCGGGTGGATCTGCCAGGATTACAGCTCGAGCTGTAATCCTGGCAGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-1331s1c1
Sequence:CCGGCCTGATTTCAAGCCCTCTGAACTCGAGTTCAGAGGGCTTGAAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-1658s1c1
Sequence:CCGGGCCAGGATTACAGTGTCCAAACTCGAGTTTGGACACTGTAATCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-616s1c1
Sequence:CCGGCACGCACTACTACATCGTCAACTCGAGTTGACGATGTAGTAGTGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033303.1-2030s1c1
Sequence:CCGGGCAATCCTTTCTGTGGATGAACTCGAGTTCATCCACAGAAAGGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-1443s1c1
Sequence:CCGGCCTTTCAGAATGTCTTGAGAACTCGAGTTCTCAAGACATTCTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033303
ADRA1A MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 1A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033303.3-1307s21c1
Sequence:CCGGGTCATGCCCATTGGGTCTTTCCTCGAGGAAAGACCCAATGGGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033303.3-2052s21c1
Sequence:CCGGCTTGCTCAGAAGCTCAATATGCTCGAGCATATTGAGCTTCTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033303.3-1613s21c1
Sequence:CCGGGGCGTTTGTGAATGGAAATTTCTCGAGAAATTTCCATTCACAAACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033303.3-1650s21c1
Sequence:CCGGGTGGATCTGCCAGGATTACAGCTCGAGCTGTAATCCTGGCAGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-1331s1c1
Sequence:CCGGCCTGATTTCAAGCCCTCTGAACTCGAGTTCAGAGGGCTTGAAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-1658s1c1
Sequence:CCGGGCCAGGATTACAGTGTCCAAACTCGAGTTTGGACACTGTAATCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-616s1c1
Sequence:CCGGCACGCACTACTACATCGTCAACTCGAGTTGACGATGTAGTAGTGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033303.1-2030s1c1
Sequence:CCGGGCAATCCTTTCTGTGGATGAACTCGAGTTCATCCACAGAAAGGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033303.1-1443s1c1
Sequence:CCGGCCTTTCAGAATGTCTTGAGAACTCGAGTTCTCAAGACATTCTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013461
ADRA1A MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 1A
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013461.3-2573s1c1
Sequence:CCGGGCTAGGATTTCAGCATATAATCTCGAGATTATATGCTGAAATCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-2103s1c1
Sequence:CCGGGACAGATGGAGTCCGTGAATGCTCGAGCATTCACGGACTCCATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1674s1c1
Sequence:CCGGAGTAAGCAGTGCCAAGAATAACTCGAGTTATTCTTGGCACTGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1446s1c1
Sequence:CCGGGGATGAGACCATCTGCCAAATCTCGAGATTTGGCAGATGGTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-2073s1c1
Sequence:CCGGCTCAGGAGAGACTTTCTATAACTCGAGTTATAGAAAGTCTCTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1108s1c1
Sequence:CCGGTCGGTGACTCACTACTACATTCTCGAGAATGTAGTAGTGAGTCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1172s1c1
Sequence:CCGGTGCCCTTCTCTGCCATCTTTGCTCGAGCAAAGATGGCAGAGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-983s1c1
Sequence:CCGGCGCCAGCACAGGTGAACATTTCTCGAGAAATGTTCACCTGTGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1630s1c1
Sequence:CCGGACGCTCCGTATCCACCGTAAACTCGAGTTTACGGTGGATACGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1889s1c1
Sequence:CCGGGTTGCATCAACCCTATCATATCTCGAGATATGATAGGGTTGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013461.2-1940s1c1
Sequence:CCGGCCTTTCAGAATGTGCTGCGAACTCGAGTTCGCAGCACATTCTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013461.2-1829s1c1
Sequence:CCGGCGAATTTCAAGCCACCGGAAACTCGAGTTTCCGGTGGCTTGAAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013461.2-2274s1c1
Sequence:CCGGCCAAGTTCCAACCATTAAGATCTCGAGATCTTAATGGTTGGAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013461.2-2842s1c1
Sequence:CCGGGCCCTGAAACTGGAGGTTTATCTCGAGATAAACCTCCAGTTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013461
ADRA1A MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 1A
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013461.3-2573s1c1
Sequence:CCGGGCTAGGATTTCAGCATATAATCTCGAGATTATATGCTGAAATCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-2103s1c1
Sequence:CCGGGACAGATGGAGTCCGTGAATGCTCGAGCATTCACGGACTCCATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1674s1c1
Sequence:CCGGAGTAAGCAGTGCCAAGAATAACTCGAGTTATTCTTGGCACTGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1446s1c1
Sequence:CCGGGGATGAGACCATCTGCCAAATCTCGAGATTTGGCAGATGGTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-2073s1c1
Sequence:CCGGCTCAGGAGAGACTTTCTATAACTCGAGTTATAGAAAGTCTCTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1108s1c1
Sequence:CCGGTCGGTGACTCACTACTACATTCTCGAGAATGTAGTAGTGAGTCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1172s1c1
Sequence:CCGGTGCCCTTCTCTGCCATCTTTGCTCGAGCAAAGATGGCAGAGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-983s1c1
Sequence:CCGGCGCCAGCACAGGTGAACATTTCTCGAGAAATGTTCACCTGTGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1630s1c1
Sequence:CCGGACGCTCCGTATCCACCGTAAACTCGAGTTTACGGTGGATACGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1889s1c1
Sequence:CCGGGTTGCATCAACCCTATCATATCTCGAGATATGATAGGGTTGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013461.2-1940s1c1
Sequence:CCGGCCTTTCAGAATGTGCTGCGAACTCGAGTTCGCAGCACATTCTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013461.2-1829s1c1
Sequence:CCGGCGAATTTCAAGCCACCGGAAACTCGAGTTTCCGGTGGCTTGAAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013461.2-2274s1c1
Sequence:CCGGCCAAGTTCCAACCATTAAGATCTCGAGATCTTAATGGTTGGAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013461.2-2842s1c1
Sequence:CCGGGCCCTGAAACTGGAGGTTTATCTCGAGATAAACCTCCAGTTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013461
ADRA1A MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 1A
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013461.3-2573s1c1
Sequence:CCGGGCTAGGATTTCAGCATATAATCTCGAGATTATATGCTGAAATCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-2103s1c1
Sequence:CCGGGACAGATGGAGTCCGTGAATGCTCGAGCATTCACGGACTCCATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1674s1c1
Sequence:CCGGAGTAAGCAGTGCCAAGAATAACTCGAGTTATTCTTGGCACTGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1446s1c1
Sequence:CCGGGGATGAGACCATCTGCCAAATCTCGAGATTTGGCAGATGGTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-2073s1c1
Sequence:CCGGCTCAGGAGAGACTTTCTATAACTCGAGTTATAGAAAGTCTCTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1108s1c1
Sequence:CCGGTCGGTGACTCACTACTACATTCTCGAGAATGTAGTAGTGAGTCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1172s1c1
Sequence:CCGGTGCCCTTCTCTGCCATCTTTGCTCGAGCAAAGATGGCAGAGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-983s1c1
Sequence:CCGGCGCCAGCACAGGTGAACATTTCTCGAGAAATGTTCACCTGTGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1630s1c1
Sequence:CCGGACGCTCCGTATCCACCGTAAACTCGAGTTTACGGTGGATACGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013461.3-1889s1c1
Sequence:CCGGGTTGCATCAACCCTATCATATCTCGAGATATGATAGGGTTGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013461.2-1940s1c1
Sequence:CCGGCCTTTCAGAATGTGCTGCGAACTCGAGTTCGCAGCACATTCTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013461.2-1829s1c1
Sequence:CCGGCGAATTTCAAGCCACCGGAAACTCGAGTTTCCGGTGGCTTGAAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013461.2-2274s1c1
Sequence:CCGGCCAAGTTCCAACCATTAAGATCTCGAGATCTTAATGGTTGGAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013461.2-2842s1c1
Sequence:CCGGGCCCTGAAACTGGAGGTTTATCTCGAGATAAACCTCCAGTTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks