EMAIL THIS PAGE TO A FRIEND

ADRA1B

adrenoceptor alpha 1B

142 Gene Product Result for
Synonyms: ADRA1 ALPHA1BAR
UniProtKB ID: P35368, B0LPE1
Gene ID:
Human(147) Summary: Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1B-adrenergic receptor, which induces neoplastic transformation when transfected into NIH 3T3 fibroblasts and other cell lines. Thus, this normal cellular gene is identified as a protooncogene. This gene comprises 2 exons and a single large intron of at least 20 kb that interrupts the coding region. [provided by RefSeq, Jul 2008]
Mouse(11548) adrenergic receptor, alpha 1b
Rat(24173) adrenoceptor alpha 1B
chicken(373890) adrenergic, alpha-1B-, receptor
domestic cat(101092238) adrenoceptor alpha 1B
cow(407140) adrenergic, alpha-1B-, receptor
dog(403962) adrenoceptor alpha 1B
domestic guinea pig(100735480) adrenoceptor alpha 1B
sheep(101114869) adrenoceptor alpha 1B
Domestic Rabbit(100008731) adrenoceptor alpha 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
V4629 (±)-Verapamil hydrochloride ≥99% (titration), powder human pricing
U101 5-Methylurapidil solid human pricing
B016 Benoxathian hydrochloride solid human pricing
B003 Chloroethylclonidine dihydrochloride solid human pricing
D4526 Doxepin hydrochloride ~85% E-isomer basis, ≥98% (GC), 15% Z-isomer basis, powder human pricing
E3263 Efaroxan hydrochloride ≥98% (HPLC) human pricing
F6145 Fenspiride hydrochloride analytical standard, for drug analysis human pricing
F4303 Fiduxosin hydrochloride >98% (HPLC), solid human pricing
M5154 Moxisylyte hydrochloride >99% (TLC), powder human pricing
N158 Naftopidil hydrochloride hydrate solid human pricing
P6402 Perphenazine human pricing
B019 Phenoxybenzamine hydrochloride ≥97%, powder human pricing
P7561 Phentolamine methanesulfonate salt ≥98% (TLC), powder human pricing
P7791 Prazosin hydrochloride ≥99% (TLC) human pricing
T4680 Terazosin hydrochloride ≥98% (TLC), powder human pricing
U100 Urapidil hydrochloride solid human pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
T5625 (±)-α-Lipoic acid synthetic, ≥99% (titration), powder human, rat pricing
T1395 (±)-α-Lipoic acid BioReagent, cell culture tested, ≥99% human, rat pricing
62320 (±)-α-Lipoic acid ≥98.0% human, rat pricing
594687 α-Sexithiophene human, rat pricing
D9815 Doxazosin mesylate ≥97% (HPLC), powder human, rat pricing
51330 Harmaline human, rat pricing
L3040 L-765,314 hydrate ≥98% (HPLC), solid human, rat pricing
S7395 Spiperone solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000679 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054451 MISSION® esiRNA esiRNA human ADRA1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000679 Rosetta Predictions human pricing
NM_016991 Rosetta Predictions rat pricing
NM_007416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162079 predicted 832
2 SASI_Hs01_00162080 predicted 352
3 SASI_Hs02_00303071 predicted 511
4 SASI_Hs01_00162081 predicted 1040
5 SASI_Hs01_00162082 predicted 481
6 SASI_Hs02_00303072 predicted 934
7 SASI_Hs01_00162083 predicted 814
8 SASI_Hs01_00162084 predicted 992
9 SASI_Hs01_00162086 predicted 675
10 SASI_Hs01_00162088 predicted 964
11 SASI_Hs01_00162085 predicted 696
12 SASI_Hs01_00162087 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056962 predicted 691
2 SASI_Rn01_00056963 predicted 623
3 SASI_Rn01_00056964 predicted 649
4 SASI_Rn01_00056965 predicted 660
5 SASI_Rn01_00056967 predicted 936
6 SASI_Rn02_00261129 predicted 1775
7 SASI_Rn01_00056968 predicted 680
8 SASI_Rn01_00056970 predicted 1107
9 SASI_Rn02_00261130 predicted 783
10 SASI_Rn02_00261131 predicted 911
11 SASI_Rn01_00056966 predicted 957
12 SASI_Rn01_00056969 predicted 575
13 SASI_Rn01_00056971 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067334 predicted 1646
2 SASI_Mm01_00067335 predicted 1220
3 SASI_Mm01_00067336 predicted 1521
4 SASI_Mm01_00067337 predicted 1013
5 SASI_Mm01_00067338 predicted 423
6 SASI_Mm01_00067339 predicted 957
7 SASI_Mm01_00067340 predicted 788
8 SASI_Mm01_00067341 predicted 1128
9 SASI_Mm01_00067342 predicted 510
10 SASI_Mm02_00311561 predicted 737
11 SASI_Mm01_00067343 predicted 1071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000679
ADRA1B MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 1B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-843s1c1
Sequence:CCGGCCGTGTCTATATAGTGGCCAACTCGAGTTGGCCACTATATAGACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-760s1c1
Sequence:CCGGGTCACCGAAGAACCCTTCTATCTCGAGATAGAAGGGTTCTTCGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-821s1c1
Sequence:CCGGCGGTCATTCTAGTCATGTACTCTCGAGAGTACATGACTAGAATGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-1093s1c1
Sequence:CCGGCTACCCTTCTTCATCGCTCTACTCGAGTAGAGCGATGAAGAAGGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-927s1c1
Sequence:CCGGCCTGAGGATCCATTCCAAGAACTCGAGTTCTTGGAATGGATCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000679.3-1061s21c1
Sequence:CCGGGGGCATTGTGGTCGGTATGTTCTCGAGAACATACCGACCACAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000679.3-2008s21c1
Sequence:CCGGGAGTCCCTCTCTACTTGTATTCTCGAGAATACAAGTAGAGAGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000679.3-835s21c1
Sequence:CCGGTCATGTACTGCCGTGTCTATACTCGAGTATAGACACGGCAGTACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000679.3-934s21c1
Sequence:CCGGGGATCCATTCCAAGAACTTTCCTCGAGGAAAGTTCTTGGAATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000679
ADRA1B MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 1B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-843s1c1
Sequence:CCGGCCGTGTCTATATAGTGGCCAACTCGAGTTGGCCACTATATAGACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-760s1c1
Sequence:CCGGGTCACCGAAGAACCCTTCTATCTCGAGATAGAAGGGTTCTTCGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-821s1c1
Sequence:CCGGCGGTCATTCTAGTCATGTACTCTCGAGAGTACATGACTAGAATGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-1093s1c1
Sequence:CCGGCTACCCTTCTTCATCGCTCTACTCGAGTAGAGCGATGAAGAAGGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-927s1c1
Sequence:CCGGCCTGAGGATCCATTCCAAGAACTCGAGTTCTTGGAATGGATCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000679.3-1061s21c1
Sequence:CCGGGGGCATTGTGGTCGGTATGTTCTCGAGAACATACCGACCACAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000679.3-2008s21c1
Sequence:CCGGGAGTCCCTCTCTACTTGTATTCTCGAGAATACAAGTAGAGAGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000679.3-835s21c1
Sequence:CCGGTCATGTACTGCCGTGTCTATACTCGAGTATAGACACGGCAGTACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000679.3-934s21c1
Sequence:CCGGGGATCCATTCCAAGAACTTTCCTCGAGGAAAGTTCTTGGAATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000679
ADRA1B MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 1B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-843s1c1
Sequence:CCGGCCGTGTCTATATAGTGGCCAACTCGAGTTGGCCACTATATAGACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-760s1c1
Sequence:CCGGGTCACCGAAGAACCCTTCTATCTCGAGATAGAAGGGTTCTTCGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-821s1c1
Sequence:CCGGCGGTCATTCTAGTCATGTACTCTCGAGAGTACATGACTAGAATGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-1093s1c1
Sequence:CCGGCTACCCTTCTTCATCGCTCTACTCGAGTAGAGCGATGAAGAAGGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000679.2-927s1c1
Sequence:CCGGCCTGAGGATCCATTCCAAGAACTCGAGTTCTTGGAATGGATCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000679.3-1061s21c1
Sequence:CCGGGGGCATTGTGGTCGGTATGTTCTCGAGAACATACCGACCACAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000679.3-2008s21c1
Sequence:CCGGGAGTCCCTCTCTACTTGTATTCTCGAGAATACAAGTAGAGAGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000679.3-835s21c1
Sequence:CCGGTCATGTACTGCCGTGTCTATACTCGAGTATAGACACGGCAGTACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000679.3-934s21c1
Sequence:CCGGGGATCCATTCCAAGAACTTTCCTCGAGGAAAGTTCTTGGAATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007416
ADRA1B MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 1B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1258s1c1
Sequence:CCGGCCTCTCCTTGGATGGAAAGAACTCGAGTTCTTTCCATCCAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1282s1c1
Sequence:CCGGGCGCCCAATGACGACAAAGAACTCGAGTTCTTTGTCGTCATTGGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1701s1c1
Sequence:CCGGCGCGGTATTCAAGGTAGTGTTCTCGAGAACACTACCTTGAATACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1392s1c1
Sequence:CCGGCCGAGTCTACATCGTGGCAAACTCGAGTTTGCCACGATGTAGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1476s1c1
Sequence:CCGGCCTGAGAATCCACTCTAAGAACTCGAGTTCTTAGAGTGGATTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007416.3-1225s21c1
Sequence:CCGGCGCCGTATTCAAGGTAGTGTTCTCGAGAACACTACCTTGAATACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007416.3-648s21c1
Sequence:CCGGGCCTATGTGCCATCTCCATTGCTCGAGCAATGGAGATGGCACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007416
ADRA1B MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 1B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1258s1c1
Sequence:CCGGCCTCTCCTTGGATGGAAAGAACTCGAGTTCTTTCCATCCAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1282s1c1
Sequence:CCGGGCGCCCAATGACGACAAAGAACTCGAGTTCTTTGTCGTCATTGGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1701s1c1
Sequence:CCGGCGCGGTATTCAAGGTAGTGTTCTCGAGAACACTACCTTGAATACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1392s1c1
Sequence:CCGGCCGAGTCTACATCGTGGCAAACTCGAGTTTGCCACGATGTAGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1476s1c1
Sequence:CCGGCCTGAGAATCCACTCTAAGAACTCGAGTTCTTAGAGTGGATTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007416.3-1225s21c1
Sequence:CCGGCGCCGTATTCAAGGTAGTGTTCTCGAGAACACTACCTTGAATACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007416.3-648s21c1
Sequence:CCGGGCCTATGTGCCATCTCCATTGCTCGAGCAATGGAGATGGCACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007416
ADRA1B MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 1B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1258s1c1
Sequence:CCGGCCTCTCCTTGGATGGAAAGAACTCGAGTTCTTTCCATCCAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1282s1c1
Sequence:CCGGGCGCCCAATGACGACAAAGAACTCGAGTTCTTTGTCGTCATTGGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1701s1c1
Sequence:CCGGCGCGGTATTCAAGGTAGTGTTCTCGAGAACACTACCTTGAATACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1392s1c1
Sequence:CCGGCCGAGTCTACATCGTGGCAAACTCGAGTTTGCCACGATGTAGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007416.1-1476s1c1
Sequence:CCGGCCTGAGAATCCACTCTAAGAACTCGAGTTCTTAGAGTGGATTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007416.3-1225s21c1
Sequence:CCGGCGCCGTATTCAAGGTAGTGTTCTCGAGAACACTACCTTGAATACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007416.3-648s21c1
Sequence:CCGGGCCTATGTGCCATCTCCATTGCTCGAGCAATGGAGATGGCACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks