EMAIL THIS PAGE TO A FRIEND

ADRA1D

adrenoceptor alpha 1D

101 Gene Product Result for
Synonyms: ADRA1 ADRA1A ADRA1R ALPHA1 DAR dJ779E11.2
UniProtKB ID: P25100, Q9NPY0
Gene ID:
Human(146) Summary: Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1D-adrenergic receptor. Similar to alpha-1B-adrenergic receptor gene, this gene comprises 2 exons and a single intron that interrupts the coding region. [provided by RefSeq, Jul 2008]
Mouse(11550) adrenergic receptor, alpha 1d
Rat(29413) adrenoceptor alpha 1D
chicken(422933) adrenergic, alpha-1D-, receptor
dog(552897) adrenergic, alpha-1D-, receptor
domestic cat(101092019) adrenoceptor alpha 1D
cow(539543) adrenergic, alpha-1D-, receptor
sheep(100170316) adrenoceptor alpha 1D
Domestic Rabbit(100009398) adrenoceptor alpha 1D
naked mole-rat(101709682) adrenoceptor alpha 1D
domestic guinea pig(100735770) adrenoceptor alpha 1D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
V4629 (±)-Verapamil hydrochloride ≥99% (titration), powder human pricing
U101 5-Methylurapidil solid human pricing
A6351 A-315456 >98% (HPLC), solid human pricing
B016 Benoxathian hydrochloride solid human pricing
B134 BMY 7378 dihydrochloride ≥98% (HPLC), solid human pricing
D4526 Doxepin hydrochloride ~85% E-isomer basis, ≥98% (GC), 15% Z-isomer basis, powder human pricing
E3263 Efaroxan hydrochloride ≥98% (HPLC) human pricing
F6145 Fenspiride hydrochloride analytical standard, for drug analysis human pricing
F4303 Fiduxosin hydrochloride >98% (HPLC), solid human pricing
M5154 Moxisylyte hydrochloride >99% (TLC), powder human pricing
N158 Naftopidil hydrochloride hydrate solid human pricing
P6402 Perphenazine human pricing
B019 Phenoxybenzamine hydrochloride ≥97%, powder human pricing
P7561 Phentolamine methanesulfonate salt ≥98% (TLC), powder human pricing
P7791 Prazosin hydrochloride ≥99% (TLC) human pricing
T4680 Terazosin hydrochloride ≥98% (TLC), powder human pricing
U100 Urapidil hydrochloride solid human pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
A7257 (−)-Norepinephrine ≥98%, crystalline human, rat pricing
D9815 Doxazosin mesylate ≥97% (HPLC), powder human, rat pricing
L3040 L-765,314 hydrate ≥98% (HPLC), solid human, rat pricing
S7395 Spiperone solid human, rat pricing
282553 (1R,2S)-(−)-Norephedrine 99% rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013460 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013460 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013460 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040011 MISSION® esiRNA esiRNA human ADRA1D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000678 Rosetta Predictions human pricing
NM_024483 Rosetta Predictions rat pricing
NM_013460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215848 predicted 1235
2 SASI_Hs02_00303065 predicted 2033
3 SASI_Hs02_00303066 predicted 1592
4 SASI_Hs01_00215849 predicted 1747
5 SASI_Hs01_00215851 predicted 1821
6 SASI_Hs01_00215852 predicted 618
7 SASI_Hs02_00303067 predicted 2142
8 SASI_Hs02_00303068 predicted 2269
9 SASI_Hs02_00303069 predicted 2223
10 SASI_Hs02_00303070 predicted 1745
11 SASI_Hs01_00215847 predicted 1138
12 SASI_Hs01_00215850 predicted 1200
13 SASI_Hs01_00215853 predicted 1217
14 SASI_Hs01_00215854 predicted 1786
15 SASI_Hs01_00215855 predicted 1725
16 SASI_Hs01_00215856 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102085 predicted 1076
2 SASI_Rn01_00102086 predicted 2315
3 SASI_Rn01_00102087 predicted 852
4 SASI_Rn01_00102088 predicted 2414
5 SASI_Rn01_00102089 predicted 1060
6 SASI_Rn01_00102090 predicted 2432
7 SASI_Rn01_00102091 predicted 923
8 SASI_Rn01_00102093 predicted 2426
9 SASI_Rn01_00102094 predicted 1419
10 SASI_Rn02_00264011 predicted 1129
11 SASI_Rn01_00102092 predicted 2631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049932 predicted 662
2 SASI_Mm01_00049933 predicted 913
3 SASI_Mm02_00322064 predicted 2034
4 SASI_Mm01_00049934 predicted 427
5 SASI_Mm01_00049935 predicted 1043
6 SASI_Mm01_00049936 predicted 706
7 SASI_Mm01_00049937 predicted 646
8 SASI_Mm02_00322065 predicted 2016
9 SASI_Mm02_00322066 predicted 1993
10 SASI_Mm02_00322067 predicted 459
11 SASI_Mm01_00049930 predicted 1622
12 SASI_Mm01_00049931 predicted 1140
13 SASI_Mm01_00049938 predicted 395
14 SASI_Mm01_00049939 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000678
ADRA1D MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 1D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000678.3-1750s21c1
Sequence:CCGGCAACCTACGGGAGACCGATATCTCGAGATATCGGTCTCCCGTAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000678.3-2035s21c1
Sequence:CCGGTTTGCTCCCAATCCCTATTTGCTCGAGCAAATAGGGATTGGGAGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000678.3-2207s21c1
Sequence:CCGGAGGGCTCCTCAGTGGACAAATCTCGAGATTTGTCCACTGAGGAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000678.3-435s21c1
Sequence:CCGGTGCAGACCGTCACCAACTATTCTCGAGAATAGTTGGTGACGGTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000678.2-1937s1c1
Sequence:CCGGTGGAGCCCTTGAAAGGTGAAACTCGAGTTTCACCTTTCAAGGGCTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000678.2-660s1c1
Sequence:CCGGACTCAAGTACCCAGCCATCATCTCGAGATGATGGCTGGGTACTTGAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000678.2-450s1c1
Sequence:CCGGCAACTATTTCATCGTGAACCTCTCGAGAGGTTCACGATGAAATAGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000678.2-1755s1c1
Sequence:CCGGCCTACGGGAGACCGATATTTACTCGAGTAAATATCGGTCTCCCGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000678
ADRA1D MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 1D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000678.3-1750s21c1
Sequence:CCGGCAACCTACGGGAGACCGATATCTCGAGATATCGGTCTCCCGTAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000678.3-2035s21c1
Sequence:CCGGTTTGCTCCCAATCCCTATTTGCTCGAGCAAATAGGGATTGGGAGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000678.3-2207s21c1
Sequence:CCGGAGGGCTCCTCAGTGGACAAATCTCGAGATTTGTCCACTGAGGAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000678.3-435s21c1
Sequence:CCGGTGCAGACCGTCACCAACTATTCTCGAGAATAGTTGGTGACGGTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000678.2-1937s1c1
Sequence:CCGGTGGAGCCCTTGAAAGGTGAAACTCGAGTTTCACCTTTCAAGGGCTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000678.2-660s1c1
Sequence:CCGGACTCAAGTACCCAGCCATCATCTCGAGATGATGGCTGGGTACTTGAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000678.2-450s1c1
Sequence:CCGGCAACTATTTCATCGTGAACCTCTCGAGAGGTTCACGATGAAATAGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000678.2-1755s1c1
Sequence:CCGGCCTACGGGAGACCGATATTTACTCGAGTAAATATCGGTCTCCCGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000678
ADRA1D MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 1D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000678.3-1750s21c1
Sequence:CCGGCAACCTACGGGAGACCGATATCTCGAGATATCGGTCTCCCGTAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000678.3-2035s21c1
Sequence:CCGGTTTGCTCCCAATCCCTATTTGCTCGAGCAAATAGGGATTGGGAGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000678.3-2207s21c1
Sequence:CCGGAGGGCTCCTCAGTGGACAAATCTCGAGATTTGTCCACTGAGGAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000678.3-435s21c1
Sequence:CCGGTGCAGACCGTCACCAACTATTCTCGAGAATAGTTGGTGACGGTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000678.2-1937s1c1
Sequence:CCGGTGGAGCCCTTGAAAGGTGAAACTCGAGTTTCACCTTTCAAGGGCTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000678.2-660s1c1
Sequence:CCGGACTCAAGTACCCAGCCATCATCTCGAGATGATGGCTGGGTACTTGAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000678.2-450s1c1
Sequence:CCGGCAACTATTTCATCGTGAACCTCTCGAGAGGTTCACGATGAAATAGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000678.2-1755s1c1
Sequence:CCGGCCTACGGGAGACCGATATTTACTCGAGTAAATATCGGTCTCCCGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013460
ADRA1D MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 1D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-1705s1c1
Sequence:CCGGGAAGCAGTGTCCCTAAATGTTCTCGAGAACATTTAGGGACACTGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-480s1c1
Sequence:CCGGGCAGACGGTCACCAACTATTTCTCGAGAAATAGTTGGTGACCGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-870s1c1
Sequence:CCGGCTCTTCCGTATGCTCCTTCTACTCGAGTAGAAGGAGCATACGGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-1272s1c1
Sequence:CCGGCTACTTCAATAGCTGTGTGAACTCGAGTTCACACAGCTATTGAAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-714s1c1
Sequence:CCGGAGCCATTATGACAGAACGCAACTCGAGTTGCGTTCTGTCATAATGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013460
ADRA1D MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 1D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-1705s1c1
Sequence:CCGGGAAGCAGTGTCCCTAAATGTTCTCGAGAACATTTAGGGACACTGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-480s1c1
Sequence:CCGGGCAGACGGTCACCAACTATTTCTCGAGAAATAGTTGGTGACCGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-870s1c1
Sequence:CCGGCTCTTCCGTATGCTCCTTCTACTCGAGTAGAAGGAGCATACGGAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-1272s1c1
Sequence:CCGGCTACTTCAATAGCTGTGTGAACTCGAGTTCACACAGCTATTGAAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-714s1c1
Sequence:CCGGAGCCATTATGACAGAACGCAACTCGAGTTGCGTTCTGTCATAATGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013460
ADRA1D MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 1D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-1705s1c1
Sequence:CCGGGAAGCAGTGTCCCTAAATGTTCTCGAGAACATTTAGGGACACTGCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-480s1c1
Sequence:CCGGGCAGACGGTCACCAACTATTTCTCGAGAAATAGTTGGTGACCGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-870s1c1
Sequence:CCGGCTCTTCCGTATGCTCCTTCTACTCGAGTAGAAGGAGCATACGGAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-1272s1c1
Sequence:CCGGCTACTTCAATAGCTGTGTGAACTCGAGTTCACACAGCTATTGAAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013460.1-714s1c1
Sequence:CCGGAGCCATTATGACAGAACGCAACTCGAGTTGCGTTCTGTCATAATGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)