EMAIL THIS PAGE TO A FRIEND

ADRA2A

adrenoceptor alpha 2A

154 Gene Product Result for
Synonyms: ADRA2 ADRA2R ADRAR ALPHA2AAR ZNF32
UniProtKB ID: P08913, B0LPF6, Q2I8G2, Q2XN99, Q86TH8, Q9BZK1
Gene ID:
Human(150) Summary: Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Studies in mouse revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons; the alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes alpha2A subtype and it contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008]
Mouse(11551) adrenergic receptor, alpha 2a
Rat(25083) adrenoceptor alpha 2A
domestic guinea pig(100135475) adrenergic receptor, alpha 2a
naked mole-rat(101723298) adrenoceptor alpha 2A
sheep(101117291) adrenoceptor alpha 2A
sheep(100170317) adrenoceptor alpha 2A
Domestic Rabbit(100009424) adrenoceptor alpha 2A
Zebrafish(266750) adrenergic, alpha-2A-, receptor
chicken(428980) adrenergic, alpha-2A-, receptor
cow(282135) adrenergic, alpha-2A-, receptor
domestic cat(664736) adrenoceptor alpha 2A
dog(486888) adrenoceptor alpha 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A271 Anti-α2A Adrenergic Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, pig, human, rat
immunohistochemistry, western blot pricing
SAB2500033 Anti-ADRA2A antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, canine, human
ELISA, immunocytochemistry, immunofluorescence pricing
SAB4500549 Anti-ADRA2A antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing
SAB4500548 Anti-Adrenergic Receptor α-2A antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
M2525 Mianserin hydrochloride human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
U104 UK 14,304 human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000681 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000681 Rosetta Predictions human pricing
NM_012739 Rosetta Predictions rat pricing
NM_007417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234408 predicted 2695
2 SASI_Hs01_00234409 predicted 2601
3 SASI_Hs01_00234410 predicted 2133
4 SASI_Hs01_00234411 predicted 2490
5 SASI_Hs01_00234412 predicted 1447
6 SASI_Hs02_00303079 predicted 2144
7 SASI_Hs01_00234413 predicted 2172
8 SASI_Hs01_00234414 predicted 1150
9 SASI_Hs01_00234415 predicted 1261
10 SASI_Hs01_00234416 predicted 1005
11 SASI_Hs01_00234417 predicted 2551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117058 predicted 376
2 SASI_Rn01_00117059 predicted 281
3 SASI_Rn02_00260089 predicted 1260
4 SASI_Rn01_00117060 predicted 265
5 SASI_Rn01_00117061 predicted 567
6 SASI_Rn01_00117063 predicted 1288
7 SASI_Rn01_00117064 predicted 550
8 SASI_Rn01_00117065 predicted 499
9 SASI_Rn01_00117066 predicted 502
10 SASI_Rn01_00117067 predicted 374
11 SASI_Rn01_00117062 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027654 predicted 1234
2 SASI_Mm01_00027655 predicted 1356
3 SASI_Mm01_00027658 predicted 1730
4 SASI_Mm01_00027659 predicted 1350
5 SASI_Mm01_00027660 predicted 1576
6 SASI_Mm01_00027661 predicted 1363
7 SASI_Mm02_00311562 predicted 1207
8 SASI_Mm02_00311563 predicted 1362
9 SASI_Mm02_00311564 predicted 1380
10 SASI_Mm02_00311565 predicted 1638
11 SASI_Mm01_00027653 predicted 2750
12 SASI_Mm01_00027656 predicted 2637
13 SASI_Mm01_00027657 predicted 2603
14 SASI_Mm01_00027662 predicted 2725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000681
VALIDATED
ADRA2A MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 2A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000681.2-3065s1c1
Sequence:CCGGGCCCTGTGTATAAAGCCATTACTCGAGTAATGGCTTTATACACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-2091s1c1
Sequence:CCGGACGCACGCTCTTCAAATTCTTCTCGAGAAGAATTTGAAGAGCGTGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-1452s1c1
Sequence:CCGGCGACCAGAAGTGGTACGTCATCTCGAGATGACGTACCACTTCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1571s21c1
Sequence:CCGGCTGCGAGATCAACGACCAGAACTCGAGTTCTGGTCGTTGATCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2738s21c1
Sequence:CCGGTTACCTAGCCCTGGCTAATTCCTCGAGGAATTAGCCAGGGCTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2833s21c1
Sequence:CCGGCCGCTGTAAATATACACTATTCTCGAGAATAGTGTATATTTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1471s21c1
Sequence:CCGGTCATCACCGTGTGGGTCATCTCTCGAGAGATGACCCACACGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1168s21c1
Sequence:CCGGTCGTCATCATCGCCGTGTTCACTCGAGTGAACACGGCGATGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1412s21c1
Sequence:CCGGCATCACACAGGCCATCGAGTACTCGAGTACTCGATGGCCTGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1316s21c1
Sequence:CCGGCAAGGCTTGGTGCGAGATCTACTCGAGTAGATCTCGCACCAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1595s21c1
Sequence:CCGGGTACGTCATCTCGTCGTGCATCTCGAGATGCACGACGAGATGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-2219s21c1
Sequence:CCGGGCCACGCACGCTCTTCAAATTCTCGAGAATTTGAAGAGCGTGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000681
VALIDATED
ADRA2A MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 2A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000681.2-3065s1c1
Sequence:CCGGGCCCTGTGTATAAAGCCATTACTCGAGTAATGGCTTTATACACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-2091s1c1
Sequence:CCGGACGCACGCTCTTCAAATTCTTCTCGAGAAGAATTTGAAGAGCGTGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-1452s1c1
Sequence:CCGGCGACCAGAAGTGGTACGTCATCTCGAGATGACGTACCACTTCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1571s21c1
Sequence:CCGGCTGCGAGATCAACGACCAGAACTCGAGTTCTGGTCGTTGATCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2738s21c1
Sequence:CCGGTTACCTAGCCCTGGCTAATTCCTCGAGGAATTAGCCAGGGCTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2833s21c1
Sequence:CCGGCCGCTGTAAATATACACTATTCTCGAGAATAGTGTATATTTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1471s21c1
Sequence:CCGGTCATCACCGTGTGGGTCATCTCTCGAGAGATGACCCACACGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1168s21c1
Sequence:CCGGTCGTCATCATCGCCGTGTTCACTCGAGTGAACACGGCGATGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1412s21c1
Sequence:CCGGCATCACACAGGCCATCGAGTACTCGAGTACTCGATGGCCTGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1316s21c1
Sequence:CCGGCAAGGCTTGGTGCGAGATCTACTCGAGTAGATCTCGCACCAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1595s21c1
Sequence:CCGGGTACGTCATCTCGTCGTGCATCTCGAGATGCACGACGAGATGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-2219s21c1
Sequence:CCGGGCCACGCACGCTCTTCAAATTCTCGAGAATTTGAAGAGCGTGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000681
VALIDATED
ADRA2A MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 2A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000681.2-3065s1c1
Sequence:CCGGGCCCTGTGTATAAAGCCATTACTCGAGTAATGGCTTTATACACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-2091s1c1
Sequence:CCGGACGCACGCTCTTCAAATTCTTCTCGAGAAGAATTTGAAGAGCGTGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-1452s1c1
Sequence:CCGGCGACCAGAAGTGGTACGTCATCTCGAGATGACGTACCACTTCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1571s21c1
Sequence:CCGGCTGCGAGATCAACGACCAGAACTCGAGTTCTGGTCGTTGATCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2738s21c1
Sequence:CCGGTTACCTAGCCCTGGCTAATTCCTCGAGGAATTAGCCAGGGCTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2833s21c1
Sequence:CCGGCCGCTGTAAATATACACTATTCTCGAGAATAGTGTATATTTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1471s21c1
Sequence:CCGGTCATCACCGTGTGGGTCATCTCTCGAGAGATGACCCACACGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1168s21c1
Sequence:CCGGTCGTCATCATCGCCGTGTTCACTCGAGTGAACACGGCGATGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1412s21c1
Sequence:CCGGCATCACACAGGCCATCGAGTACTCGAGTACTCGATGGCCTGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1316s21c1
Sequence:CCGGCAAGGCTTGGTGCGAGATCTACTCGAGTAGATCTCGCACCAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1595s21c1
Sequence:CCGGGTACGTCATCTCGTCGTGCATCTCGAGATGCACGACGAGATGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-2219s21c1
Sequence:CCGGGCCACGCACGCTCTTCAAATTCTCGAGAATTTGAAGAGCGTGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007417
ADRA2A MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 2A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-156s1c1
Sequence:CCGGGCTGGTTATTATCGCGGTGTTCTCGAGAACACCGCGATAATAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-126s1c1
Sequence:CCGGGCTCATGCTGTTCACAGTATTCTCGAGAATACTGTGAACAGCATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-651s1c1
Sequence:CCGGGCGTATTTACCAGATCGCCAACTCGAGTTGGCGATCTGGTAAATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-573s1c1
Sequence:CCGGCGACCAGAAGTGGTATGTCATCTCGAGATGACATACCACTTCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-501s1c1
Sequence:CCGGGCCACTCATCTCCATAGAGAACTCGAGTTCTCTATGGAGATGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1362s21c1
Sequence:CCGGTTATGGGTTACTGGTACTTTGCTCGAGCAAAGTACCAGTAACCCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007417.4-2799s21c1
Sequence:CCGGCCTCTAGTCCTGGCTAATTATCTCGAGATAATTAGCCAGGACTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1386s21c1
Sequence:CCGGAGGTGTGGTGTGAGATCTATTCTCGAGAATAGATCTCACACCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007417
ADRA2A MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 2A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-156s1c1
Sequence:CCGGGCTGGTTATTATCGCGGTGTTCTCGAGAACACCGCGATAATAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-126s1c1
Sequence:CCGGGCTCATGCTGTTCACAGTATTCTCGAGAATACTGTGAACAGCATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-651s1c1
Sequence:CCGGGCGTATTTACCAGATCGCCAACTCGAGTTGGCGATCTGGTAAATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-573s1c1
Sequence:CCGGCGACCAGAAGTGGTATGTCATCTCGAGATGACATACCACTTCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-501s1c1
Sequence:CCGGGCCACTCATCTCCATAGAGAACTCGAGTTCTCTATGGAGATGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1362s21c1
Sequence:CCGGTTATGGGTTACTGGTACTTTGCTCGAGCAAAGTACCAGTAACCCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007417.4-2799s21c1
Sequence:CCGGCCTCTAGTCCTGGCTAATTATCTCGAGATAATTAGCCAGGACTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1386s21c1
Sequence:CCGGAGGTGTGGTGTGAGATCTATTCTCGAGAATAGATCTCACACCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007417
ADRA2A MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 2A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-156s1c1
Sequence:CCGGGCTGGTTATTATCGCGGTGTTCTCGAGAACACCGCGATAATAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-126s1c1
Sequence:CCGGGCTCATGCTGTTCACAGTATTCTCGAGAATACTGTGAACAGCATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-651s1c1
Sequence:CCGGGCGTATTTACCAGATCGCCAACTCGAGTTGGCGATCTGGTAAATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-573s1c1
Sequence:CCGGCGACCAGAAGTGGTATGTCATCTCGAGATGACATACCACTTCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-501s1c1
Sequence:CCGGGCCACTCATCTCCATAGAGAACTCGAGTTCTCTATGGAGATGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1362s21c1
Sequence:CCGGTTATGGGTTACTGGTACTTTGCTCGAGCAAAGTACCAGTAACCCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007417.4-2799s21c1
Sequence:CCGGCCTCTAGTCCTGGCTAATTATCTCGAGATAATTAGCCAGGACTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1386s21c1
Sequence:CCGGAGGTGTGGTGTGAGATCTATTCTCGAGAATAGATCTCACACCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks