EMAIL THIS PAGE TO A FRIEND

ADRA2B

adrenoceptor alpha 2B

149 Gene Product Result for
Synonyms: ADRA2L1 ADRA2RL1 ADRARL1 ALPHA2BAR alpha-2BAR
UniProtKB ID: P18089, Q4TUH9, Q53RF2, Q9BZK0
Gene ID:
Human(151) Summary: Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. This intronless gene encodes the alpha2B subtype, which was observed to associate with eIF-2B, a guanine nucleotide exchange protein that functions in regulation of translation. A polymorphic variant of the alpha2B subtype, which lacks 3 glutamic acids from a glutamic acid repeat element, was identified to have decreased G protein-coupled receptor kinase-mediated phosphorylation and desensitization; this polymorphic form is also associated with reduced basal metabolic rate in obese subjects and may therefore contribute to the pathogenesis of obesity. [provided by RefSeq, Aug 2011]
Mouse(11552) adrenergic receptor, alpha 2b
Rat(24174) adrenoceptor alpha 2B
Zebrafish(266751) adrenergic, alpha-2B-, receptor
dog(611658) adrenergic, alpha-2B-, receptor
cow(516422) adrenergic, alpha-2B-, receptor
Horse(100051684) adrenoceptor alpha 2B
chicken(427631) adrenergic, alpha-2B-, receptor
domestic cat(101090432) adrenoceptor alpha 2B
sheep(100170318) adrenoceptor alpha 2B
naked mole-rat(101701692) adrenoceptor alpha 2B
domestic guinea pig(100135476) adrenergic receptor, alpha 2b
domestic guinea pig(100727868) adrenoceptor alpha 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
M2525 Mianserin hydrochloride human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
U104 UK 14,304 human pricing
A7257 (−)-Norepinephrine ≥98%, crystalline human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000682 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219671 MISSION® esiRNA esiRNA targeting human ADRA2B human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000682 Rosetta Predictions human pricing
NM_138505 Rosetta Predictions rat pricing
XM_579645 Rosetta Predictions rat pricing
NM_009633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138504 predicted 1265
2 SASI_Hs01_00138505 predicted 1452
3 SASI_Hs01_00138506 predicted 1257
4 SASI_Hs02_00303080 predicted 1160
5 SASI_Hs01_00138507 predicted 1717
6 SASI_Hs01_00138508 predicted 1260
7 SASI_Hs01_00138509 predicted 1831
8 SASI_Hs01_00138510 predicted 1678
9 SASI_Hs01_00138511 predicted 381
10 SASI_Hs02_00303081 predicted 1600
11 SASI_Hs01_00138512 predicted 1167
12 SASI_Hs01_00138513 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094009 predicted 585
2 SASI_Rn01_00094010 predicted 1464
3 SASI_Rn01_00094011 predicted 791
4 SASI_Rn01_00094012 predicted 1819
5 SASI_Rn01_00094013 predicted 773
6 SASI_Rn01_00094014 predicted 1871
7 SASI_Rn01_00094015 predicted 472
8 SASI_Rn02_00268095 predicted 787
9 SASI_Rn02_00268096 predicted 785
10 SASI_Rn01_00094017 predicted 647
11 SASI_Rn01_00094016 predicted 1343
12 SASI_Rn01_00094018 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149482 predicted 1476
2 SASI_Rn01_00149483 predicted 1346
3 SASI_Rn01_00149484 predicted 1665
4 SASI_Rn01_00149485 predicted 1712
5 SASI_Rn01_00149486 predicted 1328
6 SASI_Rn01_00149487 predicted 1488
7 SASI_Rn01_00149488 predicted 1559
8 SASI_Rn01_00149489 predicted 1094
9 SASI_Rn01_00149490 predicted 1616
10 SASI_Rn01_00149491 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097742 predicted 704
2 SASI_Mm01_00097743 predicted 967
3 SASI_Mm01_00097744 predicted 1622
4 SASI_Mm01_00097745 predicted 340
5 SASI_Mm01_00097746 predicted 1095
6 SASI_Mm01_00097747 predicted 841
7 SASI_Mm02_00316595 predicted 1746
8 SASI_Mm01_00097748 predicted 369
9 SASI_Mm01_00097749 predicted 864
10 SASI_Mm01_00097750 predicted 792
11 SASI_Mm01_00097751 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009633
ADRA2B MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 2B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-1018s21c1
Sequence:CCGGTCTTCTGTCGGAGAGGCTAATCTCGAGATTAGCCTCTCCGACAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-637s21c1
Sequence:CCGGAGCCGAGCATTGGAGTACAACCTCGAGGTTGTACTCCAATGCTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-704s21c1
Sequence:CCGGGGCTCATTGCAGCCGTCATTTCTCGAGAAATGACGGCTGCAATGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009633.3-1895s21c1
Sequence:CCGGTGGCCAAGGCTGATTAGAATACTCGAGTATTCTAATCAGCCTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-816s21c1
Sequence:CCGGGGCTTCCAGCATCGGATCTTTCTCGAGAAAGATCCGATGCTGGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-471s1c1
Sequence:CCGGCCTAGTGGCTACTCTTATCATCTCGAGATGATAAGAGTAGCCACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-1381s1c1
Sequence:CCGGCGAGAGAAGAGGTTCACCTTTCTCGAGAAAGGTGAACCTCTTCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-874s1c1
Sequence:CCGGCGAATCTATGTAATTGCCAAACTCGAGTTTGGCAATTACATAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009633.2-1710s1c1
Sequence:CCGGCCGCAGTCTATGTGACCATTTCTCGAGAAATGGTCACATAGACTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-387s1c1
Sequence:CCGGGCTGGTAATTCTGGCTGTGTTCTCGAGAACACAGCCAGAATTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009633
ADRA2B MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 2B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-1018s21c1
Sequence:CCGGTCTTCTGTCGGAGAGGCTAATCTCGAGATTAGCCTCTCCGACAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-637s21c1
Sequence:CCGGAGCCGAGCATTGGAGTACAACCTCGAGGTTGTACTCCAATGCTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-704s21c1
Sequence:CCGGGGCTCATTGCAGCCGTCATTTCTCGAGAAATGACGGCTGCAATGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009633.3-1895s21c1
Sequence:CCGGTGGCCAAGGCTGATTAGAATACTCGAGTATTCTAATCAGCCTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-816s21c1
Sequence:CCGGGGCTTCCAGCATCGGATCTTTCTCGAGAAAGATCCGATGCTGGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-471s1c1
Sequence:CCGGCCTAGTGGCTACTCTTATCATCTCGAGATGATAAGAGTAGCCACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-1381s1c1
Sequence:CCGGCGAGAGAAGAGGTTCACCTTTCTCGAGAAAGGTGAACCTCTTCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-874s1c1
Sequence:CCGGCGAATCTATGTAATTGCCAAACTCGAGTTTGGCAATTACATAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009633.2-1710s1c1
Sequence:CCGGCCGCAGTCTATGTGACCATTTCTCGAGAAATGGTCACATAGACTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-387s1c1
Sequence:CCGGGCTGGTAATTCTGGCTGTGTTCTCGAGAACACAGCCAGAATTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009633
ADRA2B MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 2B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-1018s21c1
Sequence:CCGGTCTTCTGTCGGAGAGGCTAATCTCGAGATTAGCCTCTCCGACAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-637s21c1
Sequence:CCGGAGCCGAGCATTGGAGTACAACCTCGAGGTTGTACTCCAATGCTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-704s21c1
Sequence:CCGGGGCTCATTGCAGCCGTCATTTCTCGAGAAATGACGGCTGCAATGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009633.3-1895s21c1
Sequence:CCGGTGGCCAAGGCTGATTAGAATACTCGAGTATTCTAATCAGCCTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009633.3-816s21c1
Sequence:CCGGGGCTTCCAGCATCGGATCTTTCTCGAGAAAGATCCGATGCTGGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-471s1c1
Sequence:CCGGCCTAGTGGCTACTCTTATCATCTCGAGATGATAAGAGTAGCCACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-1381s1c1
Sequence:CCGGCGAGAGAAGAGGTTCACCTTTCTCGAGAAAGGTGAACCTCTTCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-874s1c1
Sequence:CCGGCGAATCTATGTAATTGCCAAACTCGAGTTTGGCAATTACATAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009633.2-1710s1c1
Sequence:CCGGCCGCAGTCTATGTGACCATTTCTCGAGAAATGGTCACATAGACTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009633.2-387s1c1
Sequence:CCGGGCTGGTAATTCTGGCTGTGTTCTCGAGAACACAGCCAGAATTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000682
ADRA2B MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 2B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000682.5-1462s21c1
Sequence:CCGGATCCTGTAGGCCTCATCTTAGCTCGAGCTAAGATGAGGCCTACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000682.5-1255s21c1
Sequence:CCGGAGCTCACTGAACCCTGTTATCCTCGAGGATAACAGGGTTCAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000682.5-581s21c1
Sequence:CCGGGCATCTACCTGATCGCCAAACCTCGAGGTTTGGCGATCAGGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000682.5-734s21c1
Sequence:CCGGAGGTCAACGGACACTCGAAGTCTCGAGACTTCGAGTGTCCGTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-1254s1c1
Sequence:CCGGCAGCTCACTGAACCCTGTTATCTCGAGATAACAGGGTTCAGTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-534s1c1
Sequence:CCGGCGGATCTTTCTTTGCTCCTTGCTCGAGCAAGGAGCAAAGAAAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-1266s1c1
Sequence:CCGGCCCTGTTATCTACACCATCTTCTCGAGAAGATGGTGTAGATAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-69s1c1
Sequence:CCGGTCTCTTTACCATCTTCGGCAACTCGAGTTGCCGAAGATGGTAAAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000682
ADRA2B MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 2B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000682.5-1462s21c1
Sequence:CCGGATCCTGTAGGCCTCATCTTAGCTCGAGCTAAGATGAGGCCTACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000682.5-1255s21c1
Sequence:CCGGAGCTCACTGAACCCTGTTATCCTCGAGGATAACAGGGTTCAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000682.5-581s21c1
Sequence:CCGGGCATCTACCTGATCGCCAAACCTCGAGGTTTGGCGATCAGGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000682.5-734s21c1
Sequence:CCGGAGGTCAACGGACACTCGAAGTCTCGAGACTTCGAGTGTCCGTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-1254s1c1
Sequence:CCGGCAGCTCACTGAACCCTGTTATCTCGAGATAACAGGGTTCAGTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-534s1c1
Sequence:CCGGCGGATCTTTCTTTGCTCCTTGCTCGAGCAAGGAGCAAAGAAAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-1266s1c1
Sequence:CCGGCCCTGTTATCTACACCATCTTCTCGAGAAGATGGTGTAGATAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-69s1c1
Sequence:CCGGTCTCTTTACCATCTTCGGCAACTCGAGTTGCCGAAGATGGTAAAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000682
ADRA2B MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 2B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000682.5-1462s21c1
Sequence:CCGGATCCTGTAGGCCTCATCTTAGCTCGAGCTAAGATGAGGCCTACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000682.5-1255s21c1
Sequence:CCGGAGCTCACTGAACCCTGTTATCCTCGAGGATAACAGGGTTCAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000682.5-581s21c1
Sequence:CCGGGCATCTACCTGATCGCCAAACCTCGAGGTTTGGCGATCAGGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000682.5-734s21c1
Sequence:CCGGAGGTCAACGGACACTCGAAGTCTCGAGACTTCGAGTGTCCGTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-1254s1c1
Sequence:CCGGCAGCTCACTGAACCCTGTTATCTCGAGATAACAGGGTTCAGTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-534s1c1
Sequence:CCGGCGGATCTTTCTTTGCTCCTTGCTCGAGCAAGGAGCAAAGAAAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-1266s1c1
Sequence:CCGGCCCTGTTATCTACACCATCTTCTCGAGAAGATGGTGTAGATAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000682.3-69s1c1
Sequence:CCGGTCTCTTTACCATCTTCGGCAACTCGAGTTGCCGAAGATGGTAAAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks