EMAIL THIS PAGE TO A FRIEND

ADRA2C

adrenoceptor alpha 2C

Synonyms: ADRA2L2 ADRA2RL2 ADRARL2 ALPHA2CAR
UniProtKB ID: P18825, P35369, Q9HB49
Gene ID:
Human(152) Summary: Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. The mouse studies revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons. The alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes the alpha2C subtype, which contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008]
Mouse(11553) adrenergic receptor, alpha 2c
Rat(24175) adrenoceptor alpha 2C
domestic guinea pig(100135477) adrenergic receptor, alpha 2c
domestic guinea pig(101787589) adrenoceptor alpha 2C
sheep(100170319) adrenoceptor alpha 2C
Zebrafish(266752) adrenergic, alpha-2C-, receptor
cow(407139) alpha-2C adrenergic receptor
cow(101902575) adrenoceptor alpha 2C
chicken(428799) adrenergic, alpha-2C-, receptor
dog(488793) adrenoceptor alpha 2C
domestic cat(100529244) adrenoceptor alpha 2C
domestic cat(101087990) adrenoceptor alpha 2C
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A8606 Anti-α2C Adrenergic Receptor antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB2700740 Anti-ADRA2C (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA057688 Anti-ADRA2C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500566 Anti-Adrenergic Receptor α-2C antibody produced in rabbit affinity isolated antibody rat, mouse, human
pricing
SAB5200969 Monoclonal Anti-Alpha - Alkaline Phosphatase antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200970 Monoclonal Anti-Alpha - Apc antibody produced in mouse clone S330A-51, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5200961 Monoclonal Anti-Alpha - Atto 390 antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200962 Monoclonal Anti-Alpha - Atto 488 antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200963 Monoclonal Anti-Alpha - Atto 565 antibody produced in mouse clone S330A-51, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5200964 Monoclonal Anti-Alpha - Atto 594 antibody produced in mouse clone S330A-51, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5200965 Monoclonal Anti-Alpha - Atto 633 antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200966 Monoclonal Anti-Alpha - Atto 655 antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200967 Monoclonal Anti-Alpha - Atto 680 antibody produced in mouse clone S330A-51, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5200968 Monoclonal Anti-Alpha - Atto 700 antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200971 Monoclonal Anti-Alpha - Biotin antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200972 Monoclonal Anti-Alpha - Fitc antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200973 Monoclonal Anti-Alpha - Hrp antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200974 Monoclonal Anti-Alpha - Pe/Atto 594 antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200975 Monoclonal Anti-Alpha - Percp antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200976 Monoclonal Anti-Alpha - Rpe antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200977 Monoclonal Anti-Alpha - Streptavidin antibody produced in mouse clone S330A-51, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5201005 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Alkaline Phosphatase antibody produced in mouse clone S330A-80, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5201006 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Apc antibody produced in mouse clone S330A-80, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5200997 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Atto 390 antibody produced in mouse clone S330A-80, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5200998 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Atto 488 antibody produced in mouse clone S330A-80, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200999 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Atto 565 antibody produced in mouse clone S330A-80, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5201000 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Atto 594 antibody produced in mouse clone S330A-80, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5201001 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Atto 633 antibody produced in mouse clone S330A-80, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5201002 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Atto 655 antibody produced in mouse clone S330A-80, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5201003 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Atto 680 antibody produced in mouse clone S330A-80, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5201004 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Atto 700 antibody produced in mouse clone S330A-80, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5201007 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Biotin antibody produced in mouse clone S330A-80, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5201008 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Fitc antibody produced in mouse clone S330A-80, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5201009 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Hrp antibody produced in mouse clone S330A-80, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5201010 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Pe/Atto 594 antibody produced in mouse clone S330A-80, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5201011 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Percp antibody produced in mouse clone S330A-80, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5201012 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Rpe antibody produced in mouse clone S330A-80, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5201013 Monoclonal Anti-Alpha 2C Adrenergic Receptor - Streptavidin antibody produced in mouse clone S330A-80, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5200960 Monoclonal Anti-Alpha-2C antibody produced in mouse clone S330A-51, purified immunoglobulin human, mouse
immunocytochemistry, western blot pricing
SAB5200996 Monoclonal Anti-Alpha-2C antibody produced in mouse clone S330A-80, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
M2525 Mianserin hydrochloride human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
U104 UK 14,304 human pricing
A7257 (−)-Norepinephrine ≥98%, crystalline human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033071 MISSION® esiRNA esiRNA targeting mouse Adra2c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000683 Rosetta Predictions human pricing
NM_138506 Rosetta Predictions rat pricing
NM_007418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194116 predicted 1231
2 SASI_Hs01_00194119 predicted 1377
3 SASI_Hs01_00194122 predicted 1369
4 SASI_Hs02_00303082 predicted 700
5 SASI_Hs02_00303083 predicted 1391
6 SASI_Hs01_00194113 predicted 1326
7 SASI_Hs01_00194114 predicted 291
8 SASI_Hs01_00194115 predicted 1357
9 SASI_Hs02_00303084 predicted 395
10 SASI_Hs01_00194117 predicted 1363
11 SASI_Hs01_00194118 predicted 377
12 SASI_Hs01_00194120 predicted 1341
13 SASI_Hs01_00194121 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047290 predicted 1369
2 SASI_Rn01_00047291 predicted 753
3 SASI_Rn01_00047292 predicted 782
4 SASI_Rn01_00047293 predicted 1279
5 SASI_Rn01_00047294 predicted 255
6 SASI_Rn01_00047295 predicted 391
7 SASI_Rn01_00047296 predicted 1375
8 SASI_Rn01_00047297 predicted 449
9 SASI_Rn01_00047299 predicted 425
10 SASI_Rn02_00268097 predicted 755
11 SASI_Rn01_00047298 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148625 predicted 1981
2 SASI_Mm01_00148626 predicted 2014
3 SASI_Mm01_00148631 predicted 2882
4 SASI_Mm01_00148627 predicted 1487
5 SASI_Mm01_00148628 predicted 1647
6 SASI_Mm01_00148629 predicted 2502
7 SASI_Mm01_00148633 predicted 2873
8 SASI_Mm01_00148630 predicted 2594
9 SASI_Mm01_00148632 predicted 2089
10 SASI_Mm01_00148634 predicted 2146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000683
ADRA2C MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 2C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-2220s1c1
Sequence:CCGGCCGGCCATCCTTCAAGCACATCTCGAGATGTGCTTGAAGGATGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-2199s1c1
Sequence:CCGGCACGGTCTTCAACCAGGATTTCTCGAGAAATCCTGGTTGAAGACCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-1197s1c1
Sequence:CCGGGCTGGTCATGCCCTTCTCGTTCTCGAGAACGAGAAGGGCATGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-1503s1c1
Sequence:CCGGCAACGACGAGACCTGGTACATCTCGAGATGTACCAGGTCTCGTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000683.2-2668s1c1
Sequence:CCGGCGTCTGACCAAGGGCTGACTTCTCGAGAAGTCAGCCCTTGGTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-447s21c1
Sequence:CCGGTCGTCGATCGTGCATCTGTGTCTCGAGACACAGATGCACGATCGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-649s21c1
Sequence:CCGGTCAACGACGAGACCTGGTACACTCGAGTGTACCAGGTCTCGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-1350s21c1
Sequence:CCGGACGGTCTTCAACCAGGATTTCCTCGAGGAAATCCTGGTTGAAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-1378s21c1
Sequence:CCGGCCTTTAAGCACATCCTCTTCCCTCGAGGGAAGAGGATGTGCTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000683
ADRA2C MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 2C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-2220s1c1
Sequence:CCGGCCGGCCATCCTTCAAGCACATCTCGAGATGTGCTTGAAGGATGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-2199s1c1
Sequence:CCGGCACGGTCTTCAACCAGGATTTCTCGAGAAATCCTGGTTGAAGACCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-1197s1c1
Sequence:CCGGGCTGGTCATGCCCTTCTCGTTCTCGAGAACGAGAAGGGCATGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-1503s1c1
Sequence:CCGGCAACGACGAGACCTGGTACATCTCGAGATGTACCAGGTCTCGTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000683.2-2668s1c1
Sequence:CCGGCGTCTGACCAAGGGCTGACTTCTCGAGAAGTCAGCCCTTGGTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-447s21c1
Sequence:CCGGTCGTCGATCGTGCATCTGTGTCTCGAGACACAGATGCACGATCGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-649s21c1
Sequence:CCGGTCAACGACGAGACCTGGTACACTCGAGTGTACCAGGTCTCGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-1350s21c1
Sequence:CCGGACGGTCTTCAACCAGGATTTCCTCGAGGAAATCCTGGTTGAAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-1378s21c1
Sequence:CCGGCCTTTAAGCACATCCTCTTCCCTCGAGGGAAGAGGATGTGCTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000683
ADRA2C MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 2C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-2220s1c1
Sequence:CCGGCCGGCCATCCTTCAAGCACATCTCGAGATGTGCTTGAAGGATGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-2199s1c1
Sequence:CCGGCACGGTCTTCAACCAGGATTTCTCGAGAAATCCTGGTTGAAGACCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-1197s1c1
Sequence:CCGGGCTGGTCATGCCCTTCTCGTTCTCGAGAACGAGAAGGGCATGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000683.2-1503s1c1
Sequence:CCGGCAACGACGAGACCTGGTACATCTCGAGATGTACCAGGTCTCGTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000683.2-2668s1c1
Sequence:CCGGCGTCTGACCAAGGGCTGACTTCTCGAGAAGTCAGCCCTTGGTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-447s21c1
Sequence:CCGGTCGTCGATCGTGCATCTGTGTCTCGAGACACAGATGCACGATCGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-649s21c1
Sequence:CCGGTCAACGACGAGACCTGGTACACTCGAGTGTACCAGGTCTCGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-1350s21c1
Sequence:CCGGACGGTCTTCAACCAGGATTTCCTCGAGGAAATCCTGGTTGAAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000683.3-1378s21c1
Sequence:CCGGCCTTTAAGCACATCCTCTTCCCTCGAGGGAAGAGGATGTGCTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007418
ADRA2C MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 2C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007418.2-2977s1c1
Sequence:CCGGCCAAATACAATGACAGCCAAACTCGAGTTTGGCTGTCATTGTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-2482s1c1
Sequence:CCGGCAGGCGCTCTTTCAAGCATATCTCGAGATATGCTTGAAAGAGCGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-1777s1c1
Sequence:CCGGCGATGAGACCTGGTACATCTTCTCGAGAAGATGTACCAGGTCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-2461s1c1
Sequence:CCGGCACTGTCTTCAATCAGGACTTCTCGAGAAGTCCTGATTGAAGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-1372s1c1
Sequence:CCGGGCTCGTGGTGATCGCTGTGTTCTCGAGAACACAGCGATCACCACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007418
ADRA2C MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 2C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007418.2-2977s1c1
Sequence:CCGGCCAAATACAATGACAGCCAAACTCGAGTTTGGCTGTCATTGTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-2482s1c1
Sequence:CCGGCAGGCGCTCTTTCAAGCATATCTCGAGATATGCTTGAAAGAGCGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-1777s1c1
Sequence:CCGGCGATGAGACCTGGTACATCTTCTCGAGAAGATGTACCAGGTCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-2461s1c1
Sequence:CCGGCACTGTCTTCAATCAGGACTTCTCGAGAAGTCCTGATTGAAGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-1372s1c1
Sequence:CCGGGCTCGTGGTGATCGCTGTGTTCTCGAGAACACAGCGATCACCACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007418
ADRA2C MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 2C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007418.2-2977s1c1
Sequence:CCGGCCAAATACAATGACAGCCAAACTCGAGTTTGGCTGTCATTGTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-2482s1c1
Sequence:CCGGCAGGCGCTCTTTCAAGCATATCTCGAGATATGCTTGAAAGAGCGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-1777s1c1
Sequence:CCGGCGATGAGACCTGGTACATCTTCTCGAGAAGATGTACCAGGTCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-2461s1c1
Sequence:CCGGCACTGTCTTCAATCAGGACTTCTCGAGAAGTCCTGATTGAAGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007418.2-1372s1c1
Sequence:CCGGGCTCGTGGTGATCGCTGTGTTCTCGAGAACACAGCGATCACCACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks