EMAIL THIS PAGE TO A FRIEND

ADRB1

adrenoceptor beta 1

160 Gene Product Result for
Synonyms: ADRB1R B1AR BETA1AR RHR
UniProtKB ID: P08588, B0LPE2, Q5T5Y4, Q9UKG7, Q9UKG8
Gene ID:
Human(153) Summary: The adrenergic receptors (subtypes alpha 1, alpha 2, beta 1, and beta 2) are a prototypic family of guanine nucleotide binding regulatory protein-coupled receptors that mediate the physiological effects of the hormone epinephrine and the neurotransmitter norepinephrine. Specific polymorphisms in this gene have been shown to affect the resting heart rate and can be involved in heart failure. [provided by RefSeq, Jul 2008]
Mouse(11554) adrenergic receptor, beta 1
Rat(24925) adrenoceptor beta 1
Zebrafish(557194) adrenergic receptor, beta 1
cow(281604) adrenergic, beta-1-, receptor
domestic cat(493971) adrenoceptor beta 1
dog(493972) adrenoceptor beta 1
chicken(101750705) adrenoceptor beta 1
chicken(101666317) adrenoceptor beta 1
chicken(428983) adrenoceptor beta 1
sheep(101118321) adrenoceptor beta 1
sheep(443528) adrenoceptor beta 1
domestic guinea pig(100379595) adrenergic receptor, beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
P8688 (S)-(−)-Propranolol hydrochloride ≥98% (TLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000684 Rosetta Predictions human pricing
NM_012701 Rosetta Predictions rat pricing
NM_007419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017455 predicted 299
2 SASI_Hs01_00017456 predicted 316
3 SASI_Hs01_00017457 predicted 357
4 SASI_Hs01_00017458 predicted 1492
5 SASI_Hs01_00017459 predicted 287
6 SASI_Hs01_00017460 predicted 1494
7 SASI_Hs01_00017461 predicted 1495
8 SASI_Hs01_00017462 predicted 1457
9 SASI_Hs01_00017463 predicted 1487
10 SASI_Hs02_00303085 predicted 1239
11 SASI_Hs01_00017454 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042232 predicted 234
2 SASI_Rn01_00042233 predicted 315
3 SASI_Rn01_00042234 predicted 301
4 SASI_Rn01_00042235 predicted 368
5 SASI_Rn01_00042236 predicted 406
6 SASI_Rn01_00042237 predicted 368
7 SASI_Rn01_00042238 predicted 196
8 SASI_Rn01_00042239 predicted 394
9 SASI_Rn01_00042241 predicted 434
10 SASI_Rn02_00260015 predicted 416
11 SASI_Rn01_00042240 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090154 predicted 226
2 SASI_Mm01_00090155 predicted 927
3 SASI_Mm01_00090156 predicted 414
4 SASI_Mm01_00090157 predicted 940
5 SASI_Mm01_00090158 predicted 485
6 SASI_Mm01_00090159 predicted 729
7 SASI_Mm01_00090160 predicted 545
8 SASI_Mm01_00090161 predicted 297
9 SASI_Mm01_00090162 predicted 987
10 SASI_Mm01_00090163 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007419
ADRB1 MISSION shRNA Bacterial Glycerol Stock
adrenoceptor beta 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007419.2-1566s21c1
Sequence:CCGGAGCCCACAGATCTATCGAATCCTCGAGGATTCGATAGATCTGTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-1033s21c1
Sequence:CCGGGATCGCCTCTTCGTCTTCTTCCTCGAGGAAGAAGACGAAGAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-394s21c1
Sequence:CCGGGAGCTCTGGACTTCGGTAGATCTCGAGATCTACCGAAGTCCAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-933s1c1
Sequence:CCGGGCTCAAGACACTGGGCATCATCTCGAGATGATGCCCAGTGTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-947s1c1
Sequence:CCGGGCATCATCATGGGTGTGTTCACTCGAGTGAACACACCCATGATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-471s1c1
Sequence:CCGGCCTCGCCATCACGTCGCCCTTCTCGAGAAGGGCGACGTGATGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-207s1c1
Sequence:CCGGTCTGCTCATCGTGGTGGGTAACTCGAGTTACCCACCACGATGAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-642s1c1
Sequence:CCGGGTGCTGCGATTTCGTCACCAACTCGAGTTGGTGACGAAATCGCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007419
ADRB1 MISSION shRNA shRNA Plasmid DNA
adrenoceptor beta 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007419.2-1566s21c1
Sequence:CCGGAGCCCACAGATCTATCGAATCCTCGAGGATTCGATAGATCTGTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-1033s21c1
Sequence:CCGGGATCGCCTCTTCGTCTTCTTCCTCGAGGAAGAAGACGAAGAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-394s21c1
Sequence:CCGGGAGCTCTGGACTTCGGTAGATCTCGAGATCTACCGAAGTCCAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-933s1c1
Sequence:CCGGGCTCAAGACACTGGGCATCATCTCGAGATGATGCCCAGTGTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-947s1c1
Sequence:CCGGGCATCATCATGGGTGTGTTCACTCGAGTGAACACACCCATGATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-471s1c1
Sequence:CCGGCCTCGCCATCACGTCGCCCTTCTCGAGAAGGGCGACGTGATGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-207s1c1
Sequence:CCGGTCTGCTCATCGTGGTGGGTAACTCGAGTTACCCACCACGATGAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-642s1c1
Sequence:CCGGGTGCTGCGATTTCGTCACCAACTCGAGTTGGTGACGAAATCGCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007419
ADRB1 MISSION shRNA Lentiviral Transduction Particles
adrenoceptor beta 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007419.2-1566s21c1
Sequence:CCGGAGCCCACAGATCTATCGAATCCTCGAGGATTCGATAGATCTGTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-1033s21c1
Sequence:CCGGGATCGCCTCTTCGTCTTCTTCCTCGAGGAAGAAGACGAAGAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-394s21c1
Sequence:CCGGGAGCTCTGGACTTCGGTAGATCTCGAGATCTACCGAAGTCCAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-933s1c1
Sequence:CCGGGCTCAAGACACTGGGCATCATCTCGAGATGATGCCCAGTGTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-947s1c1
Sequence:CCGGGCATCATCATGGGTGTGTTCACTCGAGTGAACACACCCATGATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-471s1c1
Sequence:CCGGCCTCGCCATCACGTCGCCCTTCTCGAGAAGGGCGACGTGATGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-207s1c1
Sequence:CCGGTCTGCTCATCGTGGTGGGTAACTCGAGTTACCCACCACGATGAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-642s1c1
Sequence:CCGGGTGCTGCGATTTCGTCACCAACTCGAGTTGGTGACGAAATCGCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000684
ADRB1 MISSION shRNA Bacterial Glycerol Stock
adrenoceptor beta 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-767s21c1
Sequence:CCGGCTCGTCCGTAGTCTCCTTCTACTCGAGTAGAAGGAGACTACGGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1995s21c1
Sequence:CCGGACAGTTTGTCAAGACATATTTCTCGAGAAATATGTCTTGACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-797s21c1
Sequence:CCGGGTGCATCATGGCCTTCGTGTACTCGAGTACACGAAGGCCATGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1804s21c1
Sequence:CCGGTGTGCGTGTGATGCATCTTTACTCGAGTAAAGATGCATCACACGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000684.1-1563s1c1
Sequence:CCGGGAACGAGGAGATCTGTGTTTACTCGAGTAAACACAGATCTCCTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-557s1c1
Sequence:CCGGCCTCGCCATCACCTCGCCCTTCTCGAGAAGGGCGAGGTGATGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1028s1c1
Sequence:CCGGCGTGGCCCTACGCGAGCAGAACTCGAGTTCTGCTCGCGTAGGGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-359s1c1
Sequence:CCGGGCTCACCAACCTCTTCATCATCTCGAGATGATGAAGAGGTTGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1499s1c1
Sequence:CCGGCGCCTCGGAATCCAAGGTGTACTCGAGTACACCTTGGATTCCGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000684
ADRB1 MISSION shRNA shRNA Plasmid DNA
adrenoceptor beta 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-767s21c1
Sequence:CCGGCTCGTCCGTAGTCTCCTTCTACTCGAGTAGAAGGAGACTACGGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1995s21c1
Sequence:CCGGACAGTTTGTCAAGACATATTTCTCGAGAAATATGTCTTGACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-797s21c1
Sequence:CCGGGTGCATCATGGCCTTCGTGTACTCGAGTACACGAAGGCCATGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1804s21c1
Sequence:CCGGTGTGCGTGTGATGCATCTTTACTCGAGTAAAGATGCATCACACGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000684.1-1563s1c1
Sequence:CCGGGAACGAGGAGATCTGTGTTTACTCGAGTAAACACAGATCTCCTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-557s1c1
Sequence:CCGGCCTCGCCATCACCTCGCCCTTCTCGAGAAGGGCGAGGTGATGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1028s1c1
Sequence:CCGGCGTGGCCCTACGCGAGCAGAACTCGAGTTCTGCTCGCGTAGGGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-359s1c1
Sequence:CCGGGCTCACCAACCTCTTCATCATCTCGAGATGATGAAGAGGTTGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1499s1c1
Sequence:CCGGCGCCTCGGAATCCAAGGTGTACTCGAGTACACCTTGGATTCCGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000684
ADRB1 MISSION shRNA Lentiviral Transduction Particles
adrenoceptor beta 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-767s21c1
Sequence:CCGGCTCGTCCGTAGTCTCCTTCTACTCGAGTAGAAGGAGACTACGGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1995s21c1
Sequence:CCGGACAGTTTGTCAAGACATATTTCTCGAGAAATATGTCTTGACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-797s21c1
Sequence:CCGGGTGCATCATGGCCTTCGTGTACTCGAGTACACGAAGGCCATGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1804s21c1
Sequence:CCGGTGTGCGTGTGATGCATCTTTACTCGAGTAAAGATGCATCACACGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000684.1-1563s1c1
Sequence:CCGGGAACGAGGAGATCTGTGTTTACTCGAGTAAACACAGATCTCCTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-557s1c1
Sequence:CCGGCCTCGCCATCACCTCGCCCTTCTCGAGAAGGGCGAGGTGATGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1028s1c1
Sequence:CCGGCGTGGCCCTACGCGAGCAGAACTCGAGTTCTGCTCGCGTAGGGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-359s1c1
Sequence:CCGGGCTCACCAACCTCTTCATCATCTCGAGATGATGAAGAGGTTGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1499s1c1
Sequence:CCGGCGCCTCGGAATCCAAGGTGTACTCGAGTACACCTTGGATTCCGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks