EMAIL THIS PAGE TO A FRIEND

ADRB2

adrenoceptor beta 2, surface

114 Gene Product Result for
Synonyms: ADRB2R ADRBR B2AR BAR BETA2AR
Gene ID:
Human(154) Summary: This gene encodes beta-2-adrenergic receptor which is a member of the G protein-coupled receptor superfamily. This receptor is directly associated with one of its ultimate effectors, the class C L-type calcium channel Ca(V)1.2. This receptor-channel complex also contains a G protein, an adenylyl cyclase, cAMP-dependent kinase, and the counterbalancing phosphatase, PP2A. The assembly of the signaling complex provides a mechanism that ensures specific and rapid signaling by this G protein-coupled receptor. This gene is intronless. Different polymorphic forms, point mutations, and/or downregulation of this gene are associated with nocturnal asthma, obesity and type 2 diabetes. [provided by RefSeq, Jul 2008]
Mouse(11555) adrenergic receptor, beta 2
Rat(24176) adrenoceptor beta 2, surface
domestic guinea pig(100722663) adrenoceptor beta 2, surface
naked mole-rat(101708921) adrenoceptor beta 2, surface
sheep(100170320) adrenoceptor beta 2, surface
Domestic Rabbit(100340821) adrenoceptor beta 2, surface
chicken(427623) adrenergic, beta-2-, receptor, surface
domestic cat(493767) adrenoceptor beta 2, surface
cow(281605) adrenergic, beta-2-, receptor, surface
Horse(100060659) adrenoceptor beta 2, surface
dog(403910) adrenoceptor beta 2, surface
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108643 Anti-ADRB2 affinity isolated antibody human
western blot pricing
SAB1405433 Anti-ADRB2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
flow cytometry, western blot pricing
HPA003431 Anti-ADRB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2100065 Anti-ADRB2 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4500577 Anti-ADRB2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, western blot pricing
SAB4500578 Anti-ADRB2, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB2500035 Anti-ADRB2R/ADRB2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4500576 Anti-Adrenergic Receptor β2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
GW21011 Anti-β-2 Adrenergic Receptor antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
A4729 Anti-β2 Adrenergic Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunocytochemistry, immunohistochemistry pricing
SAB1306369 ANTI-BAR2 (S261) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB1306036 ANTI-BETA 2 ADRENERGIC RECEPTOR (BAR2)(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4504272 Anti-phospho-Adrenergic Receptor β2 (pSer346) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301467 Anti-phospho-Adrenergic Receptor β2 (pSer346) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504074 Anti-phospho-Adrenergic Receptor B2 (pSer355+Ser356) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1305584 ANTI-PHOSPHO-BAR2(S261) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
P8688 (S)-(−)-Propranolol hydrochloride ≥98% (TLC), powder human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0744 AQUA Peptide YQSLLT[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000024 Rosetta Predictions human pricing
NM_012492 Rosetta Predictions rat pricing
NM_007420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209061 predicted 634
2 SASI_Hs01_00209062 predicted 771
3 SASI_Hs01_00209063 predicted 736
4 SASI_Hs01_00209064 predicted 1226
5 SASI_Hs01_00209066 predicted 1160
6 SASI_Hs01_00209067 predicted 869
7 SASI_Hs01_00209068 predicted 1049
8 SASI_Hs02_00301687 predicted 781
9 SASI_Hs01_00209069 predicted 685
10 SASI_Hs02_00301688 predicted 639
11 SASI_Hs01_00209060 predicted 1140
12 SASI_Hs01_00209065 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101905 predicted 980
2 SASI_Rn02_00259525 predicted 790
3 SASI_Rn02_00259526 predicted 203
4 SASI_Rn01_00101907 predicted 373
5 SASI_Rn01_00101908 predicted 1164
6 SASI_Rn01_00101909 predicted 900
7 SASI_Rn02_00259527 predicted 995
8 SASI_Rn01_00101911 predicted 652
9 SASI_Rn01_00101912 predicted 1008
10 SASI_Rn01_00101913 predicted 370
11 SASI_Rn01_00101906 predicted 361
12 SASI_Rn01_00101910 predicted 1113
13 SASI_Rn01_00101914 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154297 predicted 374
2 SASI_Mm01_00154298 predicted 1173
3 SASI_Mm01_00154299 predicted 224
4 SASI_Mm01_00154300 predicted 1127
5 SASI_Mm01_00154301 predicted 1011
6 SASI_Mm01_00154302 predicted 1115
7 SASI_Mm01_00154303 predicted 1016
8 SASI_Mm01_00154304 predicted 380
9 SASI_Mm01_00154305 predicted 916
10 SASI_Mm01_00154306 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000024
ADRB2 MISSION shRNA Bacterial Glycerol Stock
adrenoceptor beta 2, surface
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000024.3-1673s1c1
Sequence:CCGGCCTCTTTGCATGGAATTTGTACTCGAGTACAAATTCCATGCAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1146s1c1
Sequence:CCGGCCTCCTAAATTGGATAGGCTACTCGAGTAGCCTATCCAATTTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1032s1c1
Sequence:CCGGCCTCAAGACGTTAGGCATCATCTCGAGATGATGCCTAACGTCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-760s1c1
Sequence:CCGGGCCATCAACTGCTATGCCAATCTCGAGATTGGCATAGCAGTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1206s1c1
Sequence:CCGGCCCAGATTTCAGGATTGCCTTCTCGAGAAGGCAATCCTGAAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-619s21c1
Sequence:CCGGTCGCAGTGGATCGCTACTTTGCTCGAGCAAAGTAGCGATCCACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-1412s21c1
Sequence:CCGGAGGTACTGTGCCTAGCGATAACTCGAGTTATCGCTAGGCACAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1741s21c1
Sequence:CCGGGGACCTGAGTCTGCTATATTTCTCGAGAAATATAGCAGACTCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1520s21c1
Sequence:CCGGGAACACTAAACAGACTATTTACTCGAGTAAATAGTCTGTTTAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000024
ADRB2 MISSION shRNA shRNA Plasmid DNA
adrenoceptor beta 2, surface
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000024.3-1673s1c1
Sequence:CCGGCCTCTTTGCATGGAATTTGTACTCGAGTACAAATTCCATGCAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1146s1c1
Sequence:CCGGCCTCCTAAATTGGATAGGCTACTCGAGTAGCCTATCCAATTTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1032s1c1
Sequence:CCGGCCTCAAGACGTTAGGCATCATCTCGAGATGATGCCTAACGTCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-760s1c1
Sequence:CCGGGCCATCAACTGCTATGCCAATCTCGAGATTGGCATAGCAGTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1206s1c1
Sequence:CCGGCCCAGATTTCAGGATTGCCTTCTCGAGAAGGCAATCCTGAAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-619s21c1
Sequence:CCGGTCGCAGTGGATCGCTACTTTGCTCGAGCAAAGTAGCGATCCACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-1412s21c1
Sequence:CCGGAGGTACTGTGCCTAGCGATAACTCGAGTTATCGCTAGGCACAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1741s21c1
Sequence:CCGGGGACCTGAGTCTGCTATATTTCTCGAGAAATATAGCAGACTCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1520s21c1
Sequence:CCGGGAACACTAAACAGACTATTTACTCGAGTAAATAGTCTGTTTAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000024
ADRB2 MISSION shRNA Lentiviral Transduction Particles
adrenoceptor beta 2, surface
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000024.3-1673s1c1
Sequence:CCGGCCTCTTTGCATGGAATTTGTACTCGAGTACAAATTCCATGCAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1146s1c1
Sequence:CCGGCCTCCTAAATTGGATAGGCTACTCGAGTAGCCTATCCAATTTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1032s1c1
Sequence:CCGGCCTCAAGACGTTAGGCATCATCTCGAGATGATGCCTAACGTCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-760s1c1
Sequence:CCGGGCCATCAACTGCTATGCCAATCTCGAGATTGGCATAGCAGTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1206s1c1
Sequence:CCGGCCCAGATTTCAGGATTGCCTTCTCGAGAAGGCAATCCTGAAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-619s21c1
Sequence:CCGGTCGCAGTGGATCGCTACTTTGCTCGAGCAAAGTAGCGATCCACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-1412s21c1
Sequence:CCGGAGGTACTGTGCCTAGCGATAACTCGAGTTATCGCTAGGCACAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1741s21c1
Sequence:CCGGGGACCTGAGTCTGCTATATTTCTCGAGAAATATAGCAGACTCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1520s21c1
Sequence:CCGGGAACACTAAACAGACTATTTACTCGAGTAAATAGTCTGTTTAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007420
ADRB2 MISSION shRNA Bacterial Glycerol Stock
adrenoceptor beta 2, surface
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-737s1c1
Sequence:CCGGCCCACAAGAAAGCTATCGATTCTCGAGAATCGATAGCTTTCTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1263s1c1
Sequence:CCGGCGGCTACTCTAGCAATAGCAACTCGAGTTGCTATTGCTAGAGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1110s1c1
Sequence:CCGGCCTCATCCCTAAGGAAGTTTACTCGAGTAAACTTCCTTAGGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-478s1c1
Sequence:CCGGGCCAGTCACATCCTTATGAAACTCGAGTTTCATAAGGATGTGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007420.2-1680s1c1
Sequence:CCGGCCTCTTTGTATGGAACTTAAACTCGAGTTTAAGTTCCATACAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1445s21c1
Sequence:CCGGCAAATGACTCGCCACTGTAATCTCGAGATTACAGTGGCGAGTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007420.2-1639s21c1
Sequence:CCGGACTGTATTTGAGTGCTTATTGCTCGAGCAATAAGCACTCAAATACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1080s21c1
Sequence:CCGGTGTCAATATCGTGCACGTTATCTCGAGATAACGTGCACGATATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007420
ADRB2 MISSION shRNA shRNA Plasmid DNA
adrenoceptor beta 2, surface
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-737s1c1
Sequence:CCGGCCCACAAGAAAGCTATCGATTCTCGAGAATCGATAGCTTTCTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1263s1c1
Sequence:CCGGCGGCTACTCTAGCAATAGCAACTCGAGTTGCTATTGCTAGAGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1110s1c1
Sequence:CCGGCCTCATCCCTAAGGAAGTTTACTCGAGTAAACTTCCTTAGGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-478s1c1
Sequence:CCGGGCCAGTCACATCCTTATGAAACTCGAGTTTCATAAGGATGTGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007420.2-1680s1c1
Sequence:CCGGCCTCTTTGTATGGAACTTAAACTCGAGTTTAAGTTCCATACAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1445s21c1
Sequence:CCGGCAAATGACTCGCCACTGTAATCTCGAGATTACAGTGGCGAGTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007420.2-1639s21c1
Sequence:CCGGACTGTATTTGAGTGCTTATTGCTCGAGCAATAAGCACTCAAATACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1080s21c1
Sequence:CCGGTGTCAATATCGTGCACGTTATCTCGAGATAACGTGCACGATATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007420
ADRB2 MISSION shRNA Lentiviral Transduction Particles
adrenoceptor beta 2, surface
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-737s1c1
Sequence:CCGGCCCACAAGAAAGCTATCGATTCTCGAGAATCGATAGCTTTCTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1263s1c1
Sequence:CCGGCGGCTACTCTAGCAATAGCAACTCGAGTTGCTATTGCTAGAGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1110s1c1
Sequence:CCGGCCTCATCCCTAAGGAAGTTTACTCGAGTAAACTTCCTTAGGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-478s1c1
Sequence:CCGGGCCAGTCACATCCTTATGAAACTCGAGTTTCATAAGGATGTGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007420.2-1680s1c1
Sequence:CCGGCCTCTTTGTATGGAACTTAAACTCGAGTTTAAGTTCCATACAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1445s21c1
Sequence:CCGGCAAATGACTCGCCACTGTAATCTCGAGATTACAGTGGCGAGTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007420.2-1639s21c1
Sequence:CCGGACTGTATTTGAGTGCTTATTGCTCGAGCAATAAGCACTCAAATACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1080s21c1
Sequence:CCGGTGTCAATATCGTGCACGTTATCTCGAGATAACGTGCACGATATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks