EMAIL THIS PAGE TO A FRIEND

ADRB3

adrenoceptor beta 3

112 Gene Product Result for
Synonyms: BETA3AR
UniProtKB ID: P13945, Q4JFT4
Gene ID:
Human(155) Summary: The protein encoded by this gene belongs to the family of beta adrenergic receptors, which mediate catecholamine-induced activation of adenylate cyclase through the action of G proteins. This receptor is located mainly in the adipose tissue and is involved in the regulation of lipolysis and thermogenesis. [provided by RefSeq, Feb 2009]
Mouse(11556) adrenergic receptor, beta 3
Rat(25645) adrenoceptor beta 3
dog(442979) adrenoceptor beta 3
cow(281606) adrenergic, beta-3-, receptor
domestic cat(493930) adrenoceptor beta 3
sheep(100294559) adrenoceptor beta 3
domestic guinea pig(100135478) adrenergic receptor, beta 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
P8688 (S)-(−)-Propranolol hydrochloride ≥98% (TLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000025 Rosetta Predictions human pricing
NM_013108 Rosetta Predictions rat pricing
NM_013462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015585 predicted 1892
2 SASI_Hs01_00015586 predicted 350
3 SASI_Hs01_00015587 predicted 608
4 SASI_Hs01_00015588 predicted 1875
5 SASI_Hs01_00015589 predicted 388
6 SASI_Hs01_00015590 predicted 1638
7 SASI_Hs01_00015591 predicted 1913
8 SASI_Hs01_00015592 predicted 1787
9 SASI_Hs01_00015593 predicted 1784
10 SASI_Hs01_00015594 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048319 predicted 760
2 SASI_Rn01_00048320 predicted 1167
3 SASI_Rn01_00048321 predicted 855
4 SASI_Rn01_00048322 predicted 617
5 SASI_Rn01_00048323 predicted 1196
6 SASI_Rn01_00048324 predicted 613
7 SASI_Rn01_00048325 predicted 520
8 SASI_Rn01_00048326 predicted 913
9 SASI_Rn01_00048327 predicted 402
10 SASI_Rn01_00048328 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145466 predicted 1136
2 SASI_Mm02_00322069 predicted 1013
3 SASI_Mm01_00145467 predicted 1503
4 SASI_Mm01_00145468 predicted 1207
5 SASI_Mm01_00145469 predicted 1102
6 SASI_Mm01_00145470 predicted 1445
7 SASI_Mm01_00145471 predicted 1687
8 SASI_Mm01_00145472 predicted 1811
9 SASI_Mm01_00145473 predicted 1000
10 SASI_Mm01_00145474 predicted 1848
11 SASI_Mm01_00145465 predicted 1273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000025
ADRB3 MISSION shRNA Bacterial Glycerol Stock
adrenoceptor beta 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000025.2-700s21c1
Sequence:CCGGTGTCGTTTGCGCCCATCATGACTCGAGTCATGATGGGCGCAAACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000025.2-1186s21c1
Sequence:CCGGCCCTGAACTGGCTAGGTTATGCTCGAGCATAACCTAGCCAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000025.2-1875s21c1
Sequence:CCGGTATCTCTGGTTCCCTTATTACCTCGAGGTAATAAGGGAACCAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000025.2-1906s21c1
Sequence:CCGGCAGTGGCCTCTCTCACTTTAGCTCGAGCTAAAGTGAGAGAGGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000025.1-1793s1c1
Sequence:CCGGCCCTGATGAGACCTTAGTGTTCTCGAGAACACTAAGGTCTCATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-1067s1c1
Sequence:CCGGCCTGTGCACCTTGGGTCTCATCTCGAGATGAGACCCAAGGTGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-848s1c1
Sequence:CCGGTCTCGTGATGCTCTTCGTCTACTCGAGTAGACGAAGAGCATCACGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-401s1c1
Sequence:CCGGCCAGACCATGACCAACGTGTTCTCGAGAACACGTTGGTCATGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-1192s1c1
Sequence:CCGGACTGGCTAGGTTATGCCAATTCTCGAGAATTGGCATAACCTAGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000025
ADRB3 MISSION shRNA shRNA Plasmid DNA
adrenoceptor beta 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000025.2-700s21c1
Sequence:CCGGTGTCGTTTGCGCCCATCATGACTCGAGTCATGATGGGCGCAAACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000025.2-1186s21c1
Sequence:CCGGCCCTGAACTGGCTAGGTTATGCTCGAGCATAACCTAGCCAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000025.2-1875s21c1
Sequence:CCGGTATCTCTGGTTCCCTTATTACCTCGAGGTAATAAGGGAACCAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000025.2-1906s21c1
Sequence:CCGGCAGTGGCCTCTCTCACTTTAGCTCGAGCTAAAGTGAGAGAGGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000025.1-1793s1c1
Sequence:CCGGCCCTGATGAGACCTTAGTGTTCTCGAGAACACTAAGGTCTCATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-1067s1c1
Sequence:CCGGCCTGTGCACCTTGGGTCTCATCTCGAGATGAGACCCAAGGTGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-848s1c1
Sequence:CCGGTCTCGTGATGCTCTTCGTCTACTCGAGTAGACGAAGAGCATCACGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-401s1c1
Sequence:CCGGCCAGACCATGACCAACGTGTTCTCGAGAACACGTTGGTCATGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-1192s1c1
Sequence:CCGGACTGGCTAGGTTATGCCAATTCTCGAGAATTGGCATAACCTAGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000025
ADRB3 MISSION shRNA Lentiviral Transduction Particles
adrenoceptor beta 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000025.2-700s21c1
Sequence:CCGGTGTCGTTTGCGCCCATCATGACTCGAGTCATGATGGGCGCAAACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000025.2-1186s21c1
Sequence:CCGGCCCTGAACTGGCTAGGTTATGCTCGAGCATAACCTAGCCAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000025.2-1875s21c1
Sequence:CCGGTATCTCTGGTTCCCTTATTACCTCGAGGTAATAAGGGAACCAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000025.2-1906s21c1
Sequence:CCGGCAGTGGCCTCTCTCACTTTAGCTCGAGCTAAAGTGAGAGAGGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000025.1-1793s1c1
Sequence:CCGGCCCTGATGAGACCTTAGTGTTCTCGAGAACACTAAGGTCTCATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-1067s1c1
Sequence:CCGGCCTGTGCACCTTGGGTCTCATCTCGAGATGAGACCCAAGGTGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-848s1c1
Sequence:CCGGTCTCGTGATGCTCTTCGTCTACTCGAGTAGACGAAGAGCATCACGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-401s1c1
Sequence:CCGGCCAGACCATGACCAACGTGTTCTCGAGAACACGTTGGTCATGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000025.1-1192s1c1
Sequence:CCGGACTGGCTAGGTTATGCCAATTCTCGAGAATTGGCATAACCTAGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013462
ADRB3 MISSION shRNA Bacterial Glycerol Stock
adrenoceptor beta 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-889s1c1
Sequence:CCGGGCGCACCTTAGGTCTCATTATCTCGAGATAATGAGACCTAAGGTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-181s1c1
Sequence:CCGGCCTGCTGGTAATCATAGCCATCTCGAGATGGCTATGATTACCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-220s1c1
Sequence:CCGGACAGACCATAACCAACGTGTTCTCGAGAACACGTTGGTTATGGTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-370s1c1
Sequence:CCGGGCTCTGTGTAACTGCTAGCATCTCGAGATGCTAGCAGTTACACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-667s1c1
Sequence:CCGGCCTTGTGATGCTCTTCGTCTACTCGAGTAGACGAAGAGCATCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013462
ADRB3 MISSION shRNA shRNA Plasmid DNA
adrenoceptor beta 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-889s1c1
Sequence:CCGGGCGCACCTTAGGTCTCATTATCTCGAGATAATGAGACCTAAGGTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-181s1c1
Sequence:CCGGCCTGCTGGTAATCATAGCCATCTCGAGATGGCTATGATTACCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-220s1c1
Sequence:CCGGACAGACCATAACCAACGTGTTCTCGAGAACACGTTGGTTATGGTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-370s1c1
Sequence:CCGGGCTCTGTGTAACTGCTAGCATCTCGAGATGCTAGCAGTTACACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-667s1c1
Sequence:CCGGCCTTGTGATGCTCTTCGTCTACTCGAGTAGACGAAGAGCATCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013462
ADRB3 MISSION shRNA Lentiviral Transduction Particles
adrenoceptor beta 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-889s1c1
Sequence:CCGGGCGCACCTTAGGTCTCATTATCTCGAGATAATGAGACCTAAGGTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-181s1c1
Sequence:CCGGCCTGCTGGTAATCATAGCCATCTCGAGATGGCTATGATTACCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-220s1c1
Sequence:CCGGACAGACCATAACCAACGTGTTCTCGAGAACACGTTGGTTATGGTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-370s1c1
Sequence:CCGGGCTCTGTGTAACTGCTAGCATCTCGAGATGCTAGCAGTTACACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013462.1-667s1c1
Sequence:CCGGCCTTGTGATGCTCTTCGTCTACTCGAGTAGACGAAGAGCATCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks