EMAIL THIS PAGE TO A FRIEND

ADRBK1

adrenergic, beta, receptor kinase 1

117 Gene Product Result for
Synonyms: BARK1 BETA-ARK1 GRK2
UniProtKB ID: P25098, B0ZBE1, Q13837, Q6GTT3
Gene ID:
Human(156) Summary: The product of this gene phosphorylates the beta-2-adrenergic receptor and appears to mediate agonist-specific desensitization observed at high agonist concentrations. This protein is an ubiquitous cytosolic enzyme that specifically phosphorylates the activated form of the beta-adrenergic and related G-protein-coupled receptors. Abnormal coupling of beta-adrenergic receptor to G protein is involved in the pathogenesis of the failing heart. [provided by RefSeq, Jul 2008]
Mouse(110355) adrenergic receptor kinase, beta 1
Rat(25238) adrenergic, beta, receptor kinase 1
chicken(426000) adrenergic, beta, receptor kinase 1
dog(483701) adrenergic, beta, receptor kinase 1
domestic cat(101101082) adrenergic, beta, receptor kinase 1
cow(282682) adrenergic, beta, receptor kinase 1
domestic guinea pig(100732560) adrenergic, beta, receptor kinase 1
naked mole-rat(101708906) adrenergic, beta, receptor kinase 1
sheep(101108265) adrenergic, beta, receptor kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A3232 Anti-ADRBK1 (526-540) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A3357 Anti-ADRBK1 (651-665) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA048330 Anti-ADRBK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4500593 Anti-ARBK1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB2500151 Anti-BARK1/GRK2 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, human, rat
ELISA, western blot pricing
G0296 Anti-GRK2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4500592 Anti-GRK2, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4500591 Anti-GRK2, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB1304277 ANTI-MOUSE ADRBK1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB4503920 Anti-phospho-GRK2 (pSer29) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504682 Anti-phospho-GRK2 (pSer685) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB5300349 Monoclonal Anti-ADRBK1 antibody produced in mouse clone 3F8, ascites fluid monkey, mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
G7670 Monoclonal Anti-GRK2 antibody produced in mouse clone 3A10, purified immunoglobulin, buffered aqueous solution human, bovine, rat
immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001619 siRNAs that have been validated in the lab human pricing
NM_012776 Rosetta Predictions rat pricing
XM_579349 Rosetta Predictions rat pricing
NM_130863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001619 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039321 validated 753
1 SASI_Hs01_00039322 validated 1749
2 SASI_Hs02_00332178 predicted 1752
3 SASI_Hs02_00332179 predicted 919
4 SASI_Hs01_00039324 predicted 1141
5 SASI_Hs01_00039325 predicted 1013
6 SASI_Hs01_00039327 predicted 583
7 SASI_Hs01_00039328 predicted 978
8 SASI_Hs01_00039329 predicted 767
9 SASI_Hs02_00332180 predicted 712
10 SASI_Hs01_00039323 predicted 611
11 SASI_Hs01_00039326 predicted 880
12 SASI_Hs01_00039330 predicted 1950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078899 predicted 1063
2 SASI_Rn01_00078900 predicted 1340
3 SASI_Rn01_00078901 predicted 569
4 SASI_Rn01_00078902 predicted 638
5 SASI_Rn02_00260176 predicted 1656
6 SASI_Rn01_00078903 predicted 929
7 SASI_Rn01_00078904 predicted 1975
8 SASI_Rn01_00078905 predicted 706
9 SASI_Rn01_00078907 predicted 576
10 SASI_Rn01_00078908 predicted 854
11 SASI_Rn01_00078906 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145076 predicted 822
2 SASI_Rn01_00145077 predicted 770
3 SASI_Rn01_00145078 predicted 827
4 SASI_Rn01_00145079 predicted 690
5 SASI_Rn01_00145080 predicted 663
6 SASI_Rn01_00145081 predicted 862
7 SASI_Rn01_00145082 predicted 686
8 SASI_Rn01_00145083 predicted 689
9 SASI_Rn01_00145084 predicted 746
10 SASI_Rn01_00145085 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111630 predicted 439
2 SASI_Mm01_00111631 predicted 663
3 SASI_Mm01_00111632 predicted 1848
4 SASI_Mm01_00111633 predicted 1838
5 SASI_Mm01_00111634 predicted 795
6 SASI_Mm01_00111635 predicted 1578
7 SASI_Mm01_00111636 predicted 1205
8 SASI_Mm01_00111637 predicted 1353
9 SASI_Mm01_00111638 predicted 1111
10 SASI_Mm01_00111639 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001619
ADRBK1 MISSION shRNA Bacterial Glycerol Stock
adrenergic, beta, receptor kinase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001619.x-2246s1c1
Sequence:CCGGATTATTGTGATTTCCCGTGGCCTCGAGGCCACGGGAAATCACAATAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-1546s1c1
Sequence:CCGGCTTCGATGAGGAGGACACAAACTCGAGTTTGTGTCCTCCTCATCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-586s1c1
Sequence:CCGGGAGCGATAAGTTCACACGGTTCTCGAGAACCGTGTGAACTTATCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-349s1c1
Sequence:CCGGGATCAAGAAGTACGAGAAGCTCTCGAGAGCTTCTCGTACTTCTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-587s1c1
Sequence:CCGGAGCGATAAGTTCACACGGTTTCTCGAGAAACCGTGTGAACTTATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199797    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001619.2-2340s1c1
Sequence:CCGGGCGCCCTCTGTCCTGACTTCACTCGAGTGAAGTCAGGACAGAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-2304s1c1
Sequence:CCGGCCTCGGCTCCTGCTGCACCAACTCGAGTTGGTGCAGCAGGAGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-1817s1c1
Sequence:CCGGCGGCGGTACTTCTACCTGTTCCTCGAGGAACAGGTAGAAGTACCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-1761s1c1
Sequence:CCGGGCATCATGCATGGCTACATGTCTCGAGACATGTAGCCATGCATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-401s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001619
ADRBK1 MISSION shRNA shRNA Plasmid DNA
adrenergic, beta, receptor kinase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001619.x-2246s1c1
Sequence:CCGGATTATTGTGATTTCCCGTGGCCTCGAGGCCACGGGAAATCACAATAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-1546s1c1
Sequence:CCGGCTTCGATGAGGAGGACACAAACTCGAGTTTGTGTCCTCCTCATCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-586s1c1
Sequence:CCGGGAGCGATAAGTTCACACGGTTCTCGAGAACCGTGTGAACTTATCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-349s1c1
Sequence:CCGGGATCAAGAAGTACGAGAAGCTCTCGAGAGCTTCTCGTACTTCTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-587s1c1
Sequence:CCGGAGCGATAAGTTCACACGGTTTCTCGAGAAACCGTGTGAACTTATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199797    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001619.2-2340s1c1
Sequence:CCGGGCGCCCTCTGTCCTGACTTCACTCGAGTGAAGTCAGGACAGAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-2304s1c1
Sequence:CCGGCCTCGGCTCCTGCTGCACCAACTCGAGTTGGTGCAGCAGGAGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-1817s1c1
Sequence:CCGGCGGCGGTACTTCTACCTGTTCCTCGAGGAACAGGTAGAAGTACCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-1761s1c1
Sequence:CCGGGCATCATGCATGGCTACATGTCTCGAGACATGTAGCCATGCATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-401s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001619
ADRBK1 MISSION shRNA Lentiviral Transduction Particles
adrenergic, beta, receptor kinase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001619.x-2246s1c1
Sequence:CCGGATTATTGTGATTTCCCGTGGCCTCGAGGCCACGGGAAATCACAATAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-1546s1c1
Sequence:CCGGCTTCGATGAGGAGGACACAAACTCGAGTTTGTGTCCTCCTCATCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-586s1c1
Sequence:CCGGGAGCGATAAGTTCACACGGTTCTCGAGAACCGTGTGAACTTATCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-349s1c1
Sequence:CCGGGATCAAGAAGTACGAGAAGCTCTCGAGAGCTTCTCGTACTTCTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001619.x-587s1c1
Sequence:CCGGAGCGATAAGTTCACACGGTTTCTCGAGAAACCGTGTGAACTTATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199797    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001619.2-2340s1c1
Sequence:CCGGGCGCCCTCTGTCCTGACTTCACTCGAGTGAAGTCAGGACAGAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-2304s1c1
Sequence:CCGGCCTCGGCTCCTGCTGCACCAACTCGAGTTGGTGCAGCAGGAGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-1817s1c1
Sequence:CCGGCGGCGGTACTTCTACCTGTTCCTCGAGGAACAGGTAGAAGTACCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-1761s1c1
Sequence:CCGGGCATCATGCATGGCTACATGTCTCGAGACATGTAGCCATGCATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001619.2-401s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130863
VALIDATED
ADRBK1 MISSION shRNA Bacterial Glycerol Stock
adrenergic, beta, receptor kinase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-1744s1c1
Sequence:CCGGGCGGCGATACTTCTACTTGTTCTCGAGAACAAGTAGAAGTATCGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-451s1c1
Sequence:CCGGCCAGCCATACATTGAGGAGATCTCGAGATCTCCTCAATGTATGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-332s1c1
Sequence:CCGGGAGATCTTTGACTCCTATATTCTCGAGAATATAGGAGTCAAAGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-1909s1c1
Sequence:CCGGGCAGTGTGATAGTGATCCAGACTCGAGTCTGGATCACTATCACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-1457s1c1
Sequence:CCGGGCTTTCGACATTGGCTCCTTTCTCGAGAAAGGAGCCAATGTCGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130863.1-1296s21c1
Sequence:CCGGTGTTGCAGAGGGACGTCAATCCTCGAGGATTGACGTCCCTCTGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130863.1-770s21c1
Sequence:CCGGTTCATCGTGTGCATGTCATATCTCGAGATATGACATGCACACGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130863.1-2554s21c1
Sequence:CCGGCTCTTGCCACTGGTGAGAGAACTCGAGTTCTCTCACCAGTGGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130863
VALIDATED
ADRBK1 MISSION shRNA shRNA Plasmid DNA
adrenergic, beta, receptor kinase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-1744s1c1
Sequence:CCGGGCGGCGATACTTCTACTTGTTCTCGAGAACAAGTAGAAGTATCGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-451s1c1
Sequence:CCGGCCAGCCATACATTGAGGAGATCTCGAGATCTCCTCAATGTATGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-332s1c1
Sequence:CCGGGAGATCTTTGACTCCTATATTCTCGAGAATATAGGAGTCAAAGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-1909s1c1
Sequence:CCGGGCAGTGTGATAGTGATCCAGACTCGAGTCTGGATCACTATCACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-1457s1c1
Sequence:CCGGGCTTTCGACATTGGCTCCTTTCTCGAGAAAGGAGCCAATGTCGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130863.1-1296s21c1
Sequence:CCGGTGTTGCAGAGGGACGTCAATCCTCGAGGATTGACGTCCCTCTGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130863.1-770s21c1
Sequence:CCGGTTCATCGTGTGCATGTCATATCTCGAGATATGACATGCACACGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130863.1-2554s21c1
Sequence:CCGGCTCTTGCCACTGGTGAGAGAACTCGAGTTCTCTCACCAGTGGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130863
VALIDATED
ADRBK1 MISSION shRNA Lentiviral Transduction Particles
adrenergic, beta, receptor kinase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-1744s1c1
Sequence:CCGGGCGGCGATACTTCTACTTGTTCTCGAGAACAAGTAGAAGTATCGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-451s1c1
Sequence:CCGGCCAGCCATACATTGAGGAGATCTCGAGATCTCCTCAATGTATGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-332s1c1
Sequence:CCGGGAGATCTTTGACTCCTATATTCTCGAGAATATAGGAGTCAAAGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-1909s1c1
Sequence:CCGGGCAGTGTGATAGTGATCCAGACTCGAGTCTGGATCACTATCACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130863.1-1457s1c1
Sequence:CCGGGCTTTCGACATTGGCTCCTTTCTCGAGAAAGGAGCCAATGTCGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130863.1-1296s21c1
Sequence:CCGGTGTTGCAGAGGGACGTCAATCCTCGAGGATTGACGTCCCTCTGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130863.1-770s21c1
Sequence:CCGGTTCATCGTGTGCATGTCATATCTCGAGATATGACATGCACACGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130863.1-2554s21c1
Sequence:CCGGCTCTTGCCACTGGTGAGAGAACTCGAGTTCTCTCACCAGTGGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks