EMAIL THIS PAGE TO A FRIEND

ADRBK2

adrenergic, beta, receptor kinase 2

82 Gene Product Result for
Synonyms: BARK2 GRK3
UniProtKB ID: P35626, Q9UGW9
Gene ID:
Human(157) Summary: The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
Mouse(320129) adrenergic receptor kinase, beta 2
Rat(25372) adrenergic, beta, receptor kinase 2
sheep(101117366) adrenergic, beta, receptor kinase 2
Domestic Rabbit(100349708) adrenergic, beta, receptor kinase 2
naked mole-rat(101708742) adrenergic, beta, receptor kinase 2
domestic guinea pig(100730505) adrenergic, beta, receptor kinase 2
Zebrafish(569403) adrenergic, beta, receptor kinase 2
cow(282136) adrenergic, beta, receptor kinase 2
Horse(100065495) adrenergic, beta, receptor kinase 2
domestic cat(101090393) adrenergic, beta, receptor kinase 2
dog(486327) adrenergic, beta, receptor kinase 2
chicken(416904) adrenergic, beta, receptor kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005160 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156051 MISSION® esiRNA esiRNA human ADRBK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005160 Rosetta Predictions human pricing
NM_012897 Rosetta Predictions rat pricing
XM_579356 Rosetta Predictions rat pricing
NM_001035531 Rosetta Predictions mouse pricing
NM_177078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339102 predicted 846
2 SASI_Hs01_00025366 predicted 715
3 SASI_Hs01_00025367 predicted 557
4 SASI_Hs02_00339103 predicted 931
5 SASI_Hs01_00025369 predicted 1630
6 SASI_Hs01_00025370 predicted 701
7 SASI_Hs02_00339104 predicted 2068
8 SASI_Hs01_00025372 predicted 1063
9 SASI_Hs01_00025371 predicted 1118
10 SASI_Hs01_00025373 predicted 2285
11 SASI_Hs01_00025365 predicted 1631
12 SASI_Hs01_00025368 predicted 889
13 SASI_Hs01_00025374 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032274 predicted 264
2 SASI_Rn01_00032275 predicted 1586
3 SASI_Rn01_00032276 predicted 210
4 SASI_Rn01_00032277 predicted 271
5 SASI_Rn01_00032278 predicted 1484
6 SASI_Rn02_00260423 predicted 612
7 SASI_Rn01_00032279 predicted 1372
8 SASI_Rn01_00032280 predicted 705
9 SASI_Rn01_00032281 predicted 1711
10 SASI_Rn01_00032282 predicted 792
11 SASI_Rn01_00032283 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130342 predicted 562
2 SASI_Rn01_00130343 predicted 1460
3 SASI_Rn01_00130344 predicted 1462
4 SASI_Rn01_00130345 predicted 596
5 SASI_Rn01_00130346 predicted 498
6 SASI_Rn01_00130347 predicted 424
7 SASI_Rn01_00130348 predicted 622
8 SASI_Rn01_00130349 predicted 591
9 SASI_Rn01_00130350 predicted 602
10 SASI_Rn01_00130351 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095261 predicted 219
2 SASI_Mm01_00095262 predicted 308
3 SASI_Mm01_00095263 predicted 217
4 SASI_Mm01_00095264 predicted 266
5 SASI_Mm01_00095265 predicted 263
6 SASI_Mm01_00095266 predicted 308
7 SASI_Mm01_00095267 predicted 220
8 SASI_Mm01_00095268 predicted 225
9 SASI_Mm01_00095269 predicted 229
10 SASI_Mm01_00095270 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054288 predicted 220
2 SASI_Mm01_00054289 predicted 314
3 SASI_Mm01_00054290 predicted 216
4 SASI_Mm01_00054291 predicted 261
5 SASI_Mm01_00054292 predicted 266
6 SASI_Mm01_00054293 predicted 308
7 SASI_Mm01_00054294 predicted 221
8 SASI_Mm01_00054295 predicted 223
9 SASI_Mm01_00054296 predicted 232
10 SASI_Mm01_00054297 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005160
VALIDATED
ADRBK2 MISSION shRNA Bacterial Glycerol Stock
adrenergic, beta, receptor kinase 2
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-1358s21c1
Sequence:GTACCGGGAATGACACTCACCGTGAATGCTCGAGCATTCACGGTGAGTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-2470s21c1
Sequence:CCGGCTCCTACTTATCACGTAAATTCTCGAGAATTTACGTGATAAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-450s21c1
Sequence:CCGGCCTTTGCAGAAGTCGACAAATCTCGAGATTTGTCGACTTCTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-2074s21c1
Sequence:CCGGTGGAAGAAAGAGTTGAACGAACTCGAGTTCGTTCAACTCTTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-528s21c1
Sequence:CCGGAGCTGTAGAACACGTACAAAGCTCGAGCTTTGTACGTGTTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-1869s21c1
Sequence:CCGGTCAGTGGCAGCGTCGCTATTTCTCGAGAAATAGCGACGCTGCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-2281s21c1
Sequence:GTACCGGGATGAGGCATCTGATCTATTCCTCGAGGAATAGATCAGATGCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-1312s21c1
Sequence:GTACCGGAGCCCTTTCAGACAACATAAACTCGAGTTTATGTTGTCTGAAAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-1553s1c1
Sequence:CCGGGCTACTTGATTGCGACCAAGACTCGAGTCTTGGTCGCAATCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-1259s1c1
Sequence:CCGGGCATGAAATTGACCGAATGACCTCGAGGTCATTCGGTCAATTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-1613s1c1
Sequence:CCGGGCAGCAAGAAGTAACGGAAACCTCGAGGTTTCCGTTACTTCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005160.2-2483s1c1
Sequence:CCGGCCTAAGCATTGCCACATATTCCTCGAGGAATATGTGGCAATGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005160.2-1506s1c1
Sequence:CCGGGCCTTTGATATTGGCTCATTTCTCGAGAAATGAGCCAATATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-2980s1c1
Sequence:CCGGGCAGTTGTGTGACAGTCATTCCTCGAGGAATGACTGTCACACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-2582s1c1
Sequence:CCGGGCACTTCGCAACTGACTTCTTCTCGAGAAGAAGTCAGTTGCGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-1645s1c1
Sequence:CCGGCAGTAAATGCAGACACAGATACTCGAGTATCTGTGTCTGCATTTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-630s1c1
Sequence:CCGGGAGTTCAGTGTGCATAGGATTCTCGAGAATCCTATGCACACTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-1226s1c1
Sequence:CCGGCAGCCCTTTCAGACAACATAACTCGAGTTATGTTGTCTGAAAGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-1989s1c1
Sequence:CCGGTGGAAGAAAGAGTTGAACGAACTCGAGTTCGTTCAACTCTTTCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005160
VALIDATED
ADRBK2 MISSION shRNA shRNA Plasmid DNA
adrenergic, beta, receptor kinase 2
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-1358s21c1
Sequence:GTACCGGGAATGACACTCACCGTGAATGCTCGAGCATTCACGGTGAGTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-2470s21c1
Sequence:CCGGCTCCTACTTATCACGTAAATTCTCGAGAATTTACGTGATAAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-450s21c1
Sequence:CCGGCCTTTGCAGAAGTCGACAAATCTCGAGATTTGTCGACTTCTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-2074s21c1
Sequence:CCGGTGGAAGAAAGAGTTGAACGAACTCGAGTTCGTTCAACTCTTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-528s21c1
Sequence:CCGGAGCTGTAGAACACGTACAAAGCTCGAGCTTTGTACGTGTTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-1869s21c1
Sequence:CCGGTCAGTGGCAGCGTCGCTATTTCTCGAGAAATAGCGACGCTGCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-2281s21c1
Sequence:GTACCGGGATGAGGCATCTGATCTATTCCTCGAGGAATAGATCAGATGCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-1312s21c1
Sequence:GTACCGGAGCCCTTTCAGACAACATAAACTCGAGTTTATGTTGTCTGAAAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-1553s1c1
Sequence:CCGGGCTACTTGATTGCGACCAAGACTCGAGTCTTGGTCGCAATCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-1259s1c1
Sequence:CCGGGCATGAAATTGACCGAATGACCTCGAGGTCATTCGGTCAATTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-1613s1c1
Sequence:CCGGGCAGCAAGAAGTAACGGAAACCTCGAGGTTTCCGTTACTTCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005160.2-2483s1c1
Sequence:CCGGCCTAAGCATTGCCACATATTCCTCGAGGAATATGTGGCAATGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005160.2-1506s1c1
Sequence:CCGGGCCTTTGATATTGGCTCATTTCTCGAGAAATGAGCCAATATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-2980s1c1
Sequence:CCGGGCAGTTGTGTGACAGTCATTCCTCGAGGAATGACTGTCACACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-2582s1c1
Sequence:CCGGGCACTTCGCAACTGACTTCTTCTCGAGAAGAAGTCAGTTGCGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-1645s1c1
Sequence:CCGGCAGTAAATGCAGACACAGATACTCGAGTATCTGTGTCTGCATTTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-630s1c1
Sequence:CCGGGAGTTCAGTGTGCATAGGATTCTCGAGAATCCTATGCACACTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-1226s1c1
Sequence:CCGGCAGCCCTTTCAGACAACATAACTCGAGTTATGTTGTCTGAAAGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-1989s1c1
Sequence:CCGGTGGAAGAAAGAGTTGAACGAACTCGAGTTCGTTCAACTCTTTCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005160
VALIDATED
ADRBK2 MISSION shRNA Lentiviral Transduction Particles
adrenergic, beta, receptor kinase 2
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-1358s21c1
Sequence:GTACCGGGAATGACACTCACCGTGAATGCTCGAGCATTCACGGTGAGTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-2470s21c1
Sequence:CCGGCTCCTACTTATCACGTAAATTCTCGAGAATTTACGTGATAAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-450s21c1
Sequence:CCGGCCTTTGCAGAAGTCGACAAATCTCGAGATTTGTCGACTTCTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-2074s21c1
Sequence:CCGGTGGAAGAAAGAGTTGAACGAACTCGAGTTCGTTCAACTCTTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-528s21c1
Sequence:CCGGAGCTGTAGAACACGTACAAAGCTCGAGCTTTGTACGTGTTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-1869s21c1
Sequence:CCGGTCAGTGGCAGCGTCGCTATTTCTCGAGAAATAGCGACGCTGCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-2281s21c1
Sequence:GTACCGGGATGAGGCATCTGATCTATTCCTCGAGGAATAGATCAGATGCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005160.3-1312s21c1
Sequence:GTACCGGAGCCCTTTCAGACAACATAAACTCGAGTTTATGTTGTCTGAAAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-1553s1c1
Sequence:CCGGGCTACTTGATTGCGACCAAGACTCGAGTCTTGGTCGCAATCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-1259s1c1
Sequence:CCGGGCATGAAATTGACCGAATGACCTCGAGGTCATTCGGTCAATTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-1613s1c1
Sequence:CCGGGCAGCAAGAAGTAACGGAAACCTCGAGGTTTCCGTTACTTCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005160.2-2483s1c1
Sequence:CCGGCCTAAGCATTGCCACATATTCCTCGAGGAATATGTGGCAATGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005160.2-1506s1c1
Sequence:CCGGGCCTTTGATATTGGCTCATTTCTCGAGAAATGAGCCAATATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.2-2980s1c1
Sequence:CCGGGCAGTTGTGTGACAGTCATTCCTCGAGGAATGACTGTCACACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-2582s1c1
Sequence:CCGGGCACTTCGCAACTGACTTCTTCTCGAGAAGAAGTCAGTTGCGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-1645s1c1
Sequence:CCGGCAGTAAATGCAGACACAGATACTCGAGTATCTGTGTCTGCATTTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-630s1c1
Sequence:CCGGGAGTTCAGTGTGCATAGGATTCTCGAGAATCCTATGCACACTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-1226s1c1
Sequence:CCGGCAGCCCTTTCAGACAACATAACTCGAGTTATGTTGTCTGAAAGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005160.x-1989s1c1
Sequence:CCGGTGGAAGAAAGAGTTGAACGAACTCGAGTTCGTTCAACTCTTTCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177078
ADRBK2 MISSION shRNA Bacterial Glycerol Stock
adrenergic, beta, receptor kinase 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177078.3-2285s21c1
Sequence:CCGGTCCTATCCACACTCGAAATTACTCGAGTAATTTCGAGTGTGGATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177078.3-174s21c1
Sequence:CCGGCTGGCAGAGAGAAACGAAATACTCGAGTATTTCGTTTCTCTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177078.3-1757s21c1
Sequence:CCGGACAGTGGCAAAGACGCTATTTCTCGAGAAATAGCGTCTTTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177078.3-1536s21c1
Sequence:CCGGTGTGACCAGGACCTCTATAAGCTCGAGCTTATAGAGGTCCTGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177078.2-1539s1c1
Sequence:CCGGGCCGTCAATGCTGATACTGATCTCGAGATCAGTATCAGCATTGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177078.2-1331s1c1
Sequence:CCGGGCAGCATGTGTACTTACGGAACTCGAGTTCCGTAAGTACACATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177078
ADRBK2 MISSION shRNA shRNA Plasmid DNA
adrenergic, beta, receptor kinase 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177078.3-2285s21c1
Sequence:CCGGTCCTATCCACACTCGAAATTACTCGAGTAATTTCGAGTGTGGATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177078.3-174s21c1
Sequence:CCGGCTGGCAGAGAGAAACGAAATACTCGAGTATTTCGTTTCTCTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177078.3-1757s21c1
Sequence:CCGGACAGTGGCAAAGACGCTATTTCTCGAGAAATAGCGTCTTTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177078.3-1536s21c1
Sequence:CCGGTGTGACCAGGACCTCTATAAGCTCGAGCTTATAGAGGTCCTGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177078.2-1539s1c1
Sequence:CCGGGCCGTCAATGCTGATACTGATCTCGAGATCAGTATCAGCATTGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177078.2-1331s1c1
Sequence:CCGGGCAGCATGTGTACTTACGGAACTCGAGTTCCGTAAGTACACATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177078
ADRBK2 MISSION shRNA Lentiviral Transduction Particles
adrenergic, beta, receptor kinase 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177078.3-2285s21c1
Sequence:CCGGTCCTATCCACACTCGAAATTACTCGAGTAATTTCGAGTGTGGATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177078.3-174s21c1
Sequence:CCGGCTGGCAGAGAGAAACGAAATACTCGAGTATTTCGTTTCTCTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177078.3-1757s21c1
Sequence:CCGGACAGTGGCAAAGACGCTATTTCTCGAGAAATAGCGTCTTTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177078.3-1536s21c1
Sequence:CCGGTGTGACCAGGACCTCTATAAGCTCGAGCTTATAGAGGTCCTGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177078.2-1539s1c1
Sequence:CCGGGCCGTCAATGCTGATACTGATCTCGAGATCAGTATCAGCATTGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177078.2-1331s1c1
Sequence:CCGGGCAGCATGTGTACTTACGGAACTCGAGTTCCGTAAGTACACATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks