EMAIL THIS PAGE TO A FRIEND

ADRM1

adhesion regulating molecule 1

Synonyms: ARM-1 ARM1 GP110
UniProtKB ID: Q16186, A0PKB1, Q96FJ7, Q9H1P2
Gene ID:
Human(11047) Summary: The protein encoded by this gene is an integral plasma membrane protein which promotes cell adhesion. The encoded protein is thought to undergo O-linked glycosylation. Expression of this gene has been shown to be induced by gamma interferon in some cancer cells. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56436) adhesion regulating molecule 1
Rat(65138) adhesion regulating molecule 1
naked mole-rat(101701681) adhesion regulating molecule 1
domestic guinea pig(100736167) adhesion regulating molecule 1
sheep(101112587) adhesion regulating molecule 1
Zebrafish(796450) adhesion regulating molecule 1
cow(519729) adhesion regulating molecule 1
domestic cat(101097227) adhesion regulating molecule 1
dog(477284) adhesion regulating molecule 1
chicken(395365) adhesion regulating molecule 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007002 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024991 MISSION® esiRNA esiRNA human ADRM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007002 Rosetta Predictions human pricing
NM_175573 Rosetta Predictions human pricing
NM_031708 Rosetta Predictions rat pricing
NM_019822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102560 predicted 1184
2 SASI_Hs01_00102567 predicted 1002
3 SASI_Hs01_00102561 predicted 299
4 SASI_Hs01_00102568 predicted 936
5 SASI_Hs01_00102569 predicted 944
6 SASI_Hs02_00342754 predicted 876
7 SASI_Hs02_00342755 predicted 940
8 SASI_Hs02_00342756 predicted 954
9 SASI_Hs01_00102562 predicted 1146
10 SASI_Hs01_00102563 predicted 903
11 SASI_Hs01_00102564 predicted 307
12 SASI_Hs01_00102565 predicted 430
13 SASI_Hs01_00102566 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198946 predicted 1177
2 SASI_Hs01_00198953 predicted 998
3 SASI_Hs01_00198947 predicted 295
4 SASI_Hs01_00198954 predicted 933
5 SASI_Hs01_00198955 predicted 942
6 SASI_Hs02_00369000 predicted 877
7 SASI_Hs02_00369001 predicted 941
8 SASI_Hs02_00369002 predicted 947
9 SASI_Hs01_00198948 predicted 1145
10 SASI_Hs01_00198949 predicted 899
11 SASI_Hs01_00198950 predicted 301
12 SASI_Hs01_00198951 predicted 428
13 SASI_Hs01_00198952 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056211 predicted 368
2 SASI_Rn01_00056212 predicted 1039
3 SASI_Rn02_00265065 predicted 1194
4 SASI_Rn01_00056213 predicted 339
5 SASI_Rn01_00056214 predicted 1203
6 SASI_Rn02_00265066 predicted 1170
7 SASI_Rn01_00056215 predicted 402
8 SASI_Rn01_00056216 predicted 1160
9 SASI_Rn01_00056217 predicted 1204
10 SASI_Rn01_00056220 predicted 485
11 SASI_Rn01_00056218 predicted 1177
12 SASI_Rn01_00056219 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084974 predicted 1186
2 SASI_Mm01_00084975 predicted 309
3 SASI_Mm01_00084976 predicted 951
4 SASI_Mm01_00084977 predicted 1208
5 SASI_Mm01_00084978 predicted 523
6 SASI_Mm01_00084979 predicted 378
7 SASI_Mm01_00084980 predicted 433
8 SASI_Mm01_00084981 predicted 217
9 SASI_Mm01_00084982 predicted 465
10 SASI_Mm02_00325113 predicted 897
11 SASI_Mm01_00084983 predicted 1141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007002
VALIDATED
ADRM1 MISSION shRNA Bacterial Glycerol Stock
adhesion regulating molecule 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007002.2-441s1c1
Sequence:CCGGTGCCGGAAAGTCAACGAGTATCTCGAGATACTCGTTGACTTTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007002.2-959s1c1
Sequence:CCGGGCCGGAGATAATGGCTCCCATCTCGAGATGGGAGCCATTATCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007002.2-308s1c1
Sequence:CCGGCCCTGACGACTGTGAGTTCAACTCGAGTTGAACTCACAGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007002.2-1240s1c1
Sequence:CCGGCCGAGCAGAAAGAGGGCGACACTCGAGTGTCGCCCTCTTTCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007002.2-449s1c1
Sequence:CCGGAGTCAACGAGTATCTGAACAACTCGAGTTGTTCAGATACTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-1048s21c1
Sequence:CCGGCCGCGGATGAGATCCAGAATACTCGAGTATTCTGGATCTCATCCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-193s21c1
Sequence:CCGGTGACTCCGGATAAGCGGAAAGCTCGAGCTTTCCGCTTATCCGGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-449s21c1
Sequence:CCGGAGTCAACGAGTATCTGAACAACTCGAGTTGTTCAGATACTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-231s21c1
Sequence:CCGGCAGACGGACGACTCGCTTATTCTCGAGAATAAGCGAGTCGTCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-308s21c1
Sequence:CCGGCCCTGACGACTGTGAGTTCAACTCGAGTTGAACTCACAGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007002
VALIDATED
ADRM1 MISSION shRNA shRNA Plasmid DNA
adhesion regulating molecule 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007002.2-441s1c1
Sequence:CCGGTGCCGGAAAGTCAACGAGTATCTCGAGATACTCGTTGACTTTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007002.2-959s1c1
Sequence:CCGGGCCGGAGATAATGGCTCCCATCTCGAGATGGGAGCCATTATCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007002.2-308s1c1
Sequence:CCGGCCCTGACGACTGTGAGTTCAACTCGAGTTGAACTCACAGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007002.2-1240s1c1
Sequence:CCGGCCGAGCAGAAAGAGGGCGACACTCGAGTGTCGCCCTCTTTCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007002.2-449s1c1
Sequence:CCGGAGTCAACGAGTATCTGAACAACTCGAGTTGTTCAGATACTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-1048s21c1
Sequence:CCGGCCGCGGATGAGATCCAGAATACTCGAGTATTCTGGATCTCATCCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-193s21c1
Sequence:CCGGTGACTCCGGATAAGCGGAAAGCTCGAGCTTTCCGCTTATCCGGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-449s21c1
Sequence:CCGGAGTCAACGAGTATCTGAACAACTCGAGTTGTTCAGATACTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-231s21c1
Sequence:CCGGCAGACGGACGACTCGCTTATTCTCGAGAATAAGCGAGTCGTCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-308s21c1
Sequence:CCGGCCCTGACGACTGTGAGTTCAACTCGAGTTGAACTCACAGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007002
VALIDATED
ADRM1 MISSION shRNA Lentiviral Transduction Particles
adhesion regulating molecule 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007002.2-441s1c1
Sequence:CCGGTGCCGGAAAGTCAACGAGTATCTCGAGATACTCGTTGACTTTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007002.2-959s1c1
Sequence:CCGGGCCGGAGATAATGGCTCCCATCTCGAGATGGGAGCCATTATCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007002.2-308s1c1
Sequence:CCGGCCCTGACGACTGTGAGTTCAACTCGAGTTGAACTCACAGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007002.2-1240s1c1
Sequence:CCGGCCGAGCAGAAAGAGGGCGACACTCGAGTGTCGCCCTCTTTCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007002.2-449s1c1
Sequence:CCGGAGTCAACGAGTATCTGAACAACTCGAGTTGTTCAGATACTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-1048s21c1
Sequence:CCGGCCGCGGATGAGATCCAGAATACTCGAGTATTCTGGATCTCATCCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-193s21c1
Sequence:CCGGTGACTCCGGATAAGCGGAAAGCTCGAGCTTTCCGCTTATCCGGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-449s21c1
Sequence:CCGGAGTCAACGAGTATCTGAACAACTCGAGTTGTTCAGATACTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-231s21c1
Sequence:CCGGCAGACGGACGACTCGCTTATTCTCGAGAATAAGCGAGTCGTCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007002.2-308s21c1
Sequence:CCGGCCCTGACGACTGTGAGTTCAACTCGAGTTGAACTCACAGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019822
VALIDATED
ADRM1 MISSION shRNA Bacterial Glycerol Stock
adhesion regulating molecule 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-1241s1c1
Sequence:CCGGCCATGCAGAACAATGCCAAATCTCGAGATTTGGCATTGTTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-316s1c1
Sequence:CCGGGACTTGATTATCTTTCCTGATCTCGAGATCAGGAAAGATAATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-268s1c1
Sequence:CCGGCTTATTCACTTCTGTTGGAAACTCGAGTTTCCAACAGAAGTGAATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-1300s1c1
Sequence:CCGGGAAGAAGAAGATATGAGTCTACTCGAGTAGACTCATATCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-1073s1c1
Sequence:CCGGCAGATGAGATCCAGAACACATCTCGAGATGTGTTCTGGATCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-1241s21c1
Sequence:CCGGCCATGCAGAACAATGCCAAATCTCGAGATTTGGCATTGTTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-316s21c1
Sequence:CCGGGACTTGATTATCTTTCCTGATCTCGAGATCAGGAAAGATAATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-1073s21c1
Sequence:CCGGCAGATGAGATCCAGAACACATCTCGAGATGTGTTCTGGATCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-268s21c1
Sequence:CCGGCTTATTCACTTCTGTTGGAAACTCGAGTTTCCAACAGAAGTGAATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-1300s21c1
Sequence:CCGGGAAGAAGAAGATATGAGTCTACTCGAGTAGACTCATATCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019822
VALIDATED
ADRM1 MISSION shRNA shRNA Plasmid DNA
adhesion regulating molecule 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-1241s1c1
Sequence:CCGGCCATGCAGAACAATGCCAAATCTCGAGATTTGGCATTGTTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-316s1c1
Sequence:CCGGGACTTGATTATCTTTCCTGATCTCGAGATCAGGAAAGATAATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-268s1c1
Sequence:CCGGCTTATTCACTTCTGTTGGAAACTCGAGTTTCCAACAGAAGTGAATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-1300s1c1
Sequence:CCGGGAAGAAGAAGATATGAGTCTACTCGAGTAGACTCATATCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-1073s1c1
Sequence:CCGGCAGATGAGATCCAGAACACATCTCGAGATGTGTTCTGGATCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-1241s21c1
Sequence:CCGGCCATGCAGAACAATGCCAAATCTCGAGATTTGGCATTGTTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-316s21c1
Sequence:CCGGGACTTGATTATCTTTCCTGATCTCGAGATCAGGAAAGATAATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-1073s21c1
Sequence:CCGGCAGATGAGATCCAGAACACATCTCGAGATGTGTTCTGGATCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-268s21c1
Sequence:CCGGCTTATTCACTTCTGTTGGAAACTCGAGTTTCCAACAGAAGTGAATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-1300s21c1
Sequence:CCGGGAAGAAGAAGATATGAGTCTACTCGAGTAGACTCATATCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019822
VALIDATED
ADRM1 MISSION shRNA Lentiviral Transduction Particles
adhesion regulating molecule 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-1241s1c1
Sequence:CCGGCCATGCAGAACAATGCCAAATCTCGAGATTTGGCATTGTTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-316s1c1
Sequence:CCGGGACTTGATTATCTTTCCTGATCTCGAGATCAGGAAAGATAATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-268s1c1
Sequence:CCGGCTTATTCACTTCTGTTGGAAACTCGAGTTTCCAACAGAAGTGAATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-1300s1c1
Sequence:CCGGGAAGAAGAAGATATGAGTCTACTCGAGTAGACTCATATCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019822.2-1073s1c1
Sequence:CCGGCAGATGAGATCCAGAACACATCTCGAGATGTGTTCTGGATCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-1241s21c1
Sequence:CCGGCCATGCAGAACAATGCCAAATCTCGAGATTTGGCATTGTTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-316s21c1
Sequence:CCGGGACTTGATTATCTTTCCTGATCTCGAGATCAGGAAAGATAATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-1073s21c1
Sequence:CCGGCAGATGAGATCCAGAACACATCTCGAGATGTGTTCTGGATCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-268s21c1
Sequence:CCGGCTTATTCACTTCTGTTGGAAACTCGAGTTTCCAACAGAAGTGAATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019822.3-1300s21c1
Sequence:CCGGGAAGAAGAAGATATGAGTCTACTCGAGTAGACTCATATCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks