EMAIL THIS PAGE TO A FRIEND

ADSL

adenylosuccinate lyase

64 Gene Product Result for
Synonyms: AMPS ASASE ASL
UniProtKB ID: P30566, B0QY76, O75495, Q5TI34
Gene ID:
Human(158) Summary: Adenylsuccinate lyase is involved in both de novo synthesis of purines and formation of adenosine monophosphate from inosine monophosphate. It catalyzes two reactions in AMP biosynthesis: the removal of a fumarate from succinylaminoimidazole carboxamide (SAICA) ribotide to give aminoimidazole carboxamide ribotide (AICA) and removal of fumarate from adenylosuccinate to give AMP. Adenylosuccinase deficiency results in succinylpurinemic autism, psychomotor retardation, and , in some cases, growth retardation associated with muscle wasting and epilepsy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11564) adenylosuccinate lyase
Rat(315150) adenylosuccinate lyase
naked mole-rat(101719217) adenylosuccinate lyase
domestic guinea pig(100713101) adenylosuccinate lyase
sheep(101108120) adenylosuccinate lyase
Zebrafish(334431) adenylosuccinate lyase
chicken(396540) adenylosuccinate lyase
domestic cat(101085644) adenylosuccinate lyase
cow(510949) adenylosuccinate lyase
dog(474499) adenylosuccinate lyase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000026 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000026 Rosetta Predictions human pricing
NM_001123378 Rosetta Predictions human pricing
NM_001130503 Rosetta Predictions rat pricing
NM_009634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181482 predicted 407
2 SASI_Hs01_00181483 predicted 402
3 SASI_Hs02_00301689 predicted 675
4 SASI_Hs02_00301690 predicted 749
5 SASI_Hs01_00181487 predicted 914
6 SASI_Hs01_00181488 predicted 297
7 SASI_Hs01_00181490 predicted 512
8 SASI_Hs01_00181491 predicted 836
9 SASI_Hs02_00301691 predicted 206
10 SASI_Hs02_00301692 predicted 455
11 SASI_Hs01_00181484 predicted 1253
12 SASI_Hs01_00181485 predicted 686
13 SASI_Hs01_00181486 predicted 692
14 SASI_Hs01_00181489 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327856 predicted 410
2 SASI_Hs02_00327857 predicted 404
3 SASI_Hs02_00327858 predicted 674
4 SASI_Hs02_00327859 predicted 746
5 SASI_Hs02_00327860 predicted 914
6 SASI_Hs02_00327861 predicted 298
7 SASI_Hs02_00327862 predicted 508
8 SASI_Hs02_00327863 predicted 838
9 SASI_Hs02_00327864 predicted 200
10 SASI_Hs02_00327865 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255459 predicted 1083
2 SASI_Rn02_00255460 predicted 705
3 SASI_Rn02_00255461 predicted 1169
4 SASI_Rn02_00255462 predicted 819
5 SASI_Rn02_00255463 predicted 1022
6 SASI_Rn02_00255464 predicted 1517
7 SASI_Rn02_00255465 predicted 1336
8 SASI_Rn02_00255466 predicted 894
9 SASI_Rn02_00255467 predicted 398
10 SASI_Rn02_00255468 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052479 predicted 689
2 SASI_Mm02_00316596 predicted 388
3 SASI_Mm01_00052480 predicted 1038
4 SASI_Mm01_00052481 predicted 881
5 SASI_Mm02_00316597 predicted 1428
6 SASI_Mm01_00052484 predicted 423
7 SASI_Mm01_00052485 predicted 328
8 SASI_Mm01_00052486 predicted 391
9 SASI_Mm01_00052488 predicted 1175
10 SASI_Mm02_00316598 predicted 1094
11 SASI_Mm01_00052482 predicted 1541
12 SASI_Mm01_00052483 predicted 1067
13 SASI_Mm01_00052487 predicted 1453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000026
VALIDATED
ADSL MISSION shRNA Bacterial Glycerol Stock
adenylosuccinate lyase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-693s21c1
Sequence:CCGGTTTGAGGGAGATGACCATAAGCTCGAGCTTATGGTCATCTCCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-847s21c1
Sequence:CCGGACAAGATTTGCACCGACATACCTCGAGGTATGTCGGTGCAAATCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-1487s21c1
Sequence:CCGGGAAGGTGAAAGCAGAATTATGCTCGAGCATAATTCTGCTTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-406s21c1
Sequence:CCCGGAGACAATACTGACTTGATTACTCGAGTAATCAAGTCAGTATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-144s21c1
Sequence:CCGGGTGTTTAGCGACAGGTATAAACTCGAGTTTATACCTGTCGCTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-1040s21c1
Sequence:CCGGTGAACGCACACTGGATGATAGCTCGAGCTATCATCCAGTGTGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000026.1-1535s1c2
Sequence:CCGGCCTCGAGAATTGTTACCTTAACTCGAGTTAAGGTAACAATTCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-1042s1c1
Sequence:CCGGCCGCAGATACTATATTGAATACTCGAGTATTCAATATAGTATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-460s1c1
Sequence:CCGGCCACATTAGGTTTCACACATTCTCGAGAATGTGTGAAACCTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-1067s1c1
Sequence:CCGGGCAGAACATTTCTGAAGGATTCTCGAGAATCCTTCAGAAATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-873s1c1
Sequence:CCGGGCGATGCCATATAAGCGGAATCTCGAGATTCCGCTTATATGGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000026
VALIDATED
ADSL MISSION shRNA shRNA Plasmid DNA
adenylosuccinate lyase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-693s21c1
Sequence:CCGGTTTGAGGGAGATGACCATAAGCTCGAGCTTATGGTCATCTCCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-847s21c1
Sequence:CCGGACAAGATTTGCACCGACATACCTCGAGGTATGTCGGTGCAAATCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-1487s21c1
Sequence:CCGGGAAGGTGAAAGCAGAATTATGCTCGAGCATAATTCTGCTTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-406s21c1
Sequence:CCCGGAGACAATACTGACTTGATTACTCGAGTAATCAAGTCAGTATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-144s21c1
Sequence:CCGGGTGTTTAGCGACAGGTATAAACTCGAGTTTATACCTGTCGCTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-1040s21c1
Sequence:CCGGTGAACGCACACTGGATGATAGCTCGAGCTATCATCCAGTGTGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000026.1-1535s1c2
Sequence:CCGGCCTCGAGAATTGTTACCTTAACTCGAGTTAAGGTAACAATTCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-1042s1c1
Sequence:CCGGCCGCAGATACTATATTGAATACTCGAGTATTCAATATAGTATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-460s1c1
Sequence:CCGGCCACATTAGGTTTCACACATTCTCGAGAATGTGTGAAACCTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-1067s1c1
Sequence:CCGGGCAGAACATTTCTGAAGGATTCTCGAGAATCCTTCAGAAATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-873s1c1
Sequence:CCGGGCGATGCCATATAAGCGGAATCTCGAGATTCCGCTTATATGGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000026
VALIDATED
ADSL MISSION shRNA Lentiviral Transduction Particles
adenylosuccinate lyase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-693s21c1
Sequence:CCGGTTTGAGGGAGATGACCATAAGCTCGAGCTTATGGTCATCTCCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-847s21c1
Sequence:CCGGACAAGATTTGCACCGACATACCTCGAGGTATGTCGGTGCAAATCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-1487s21c1
Sequence:CCGGGAAGGTGAAAGCAGAATTATGCTCGAGCATAATTCTGCTTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-406s21c1
Sequence:CCCGGAGACAATACTGACTTGATTACTCGAGTAATCAAGTCAGTATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-144s21c1
Sequence:CCGGGTGTTTAGCGACAGGTATAAACTCGAGTTTATACCTGTCGCTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000026.2-1040s21c1
Sequence:CCGGTGAACGCACACTGGATGATAGCTCGAGCTATCATCCAGTGTGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000026.1-1535s1c2
Sequence:CCGGCCTCGAGAATTGTTACCTTAACTCGAGTTAAGGTAACAATTCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-1042s1c1
Sequence:CCGGCCGCAGATACTATATTGAATACTCGAGTATTCAATATAGTATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-460s1c1
Sequence:CCGGCCACATTAGGTTTCACACATTCTCGAGAATGTGTGAAACCTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-1067s1c1
Sequence:CCGGGCAGAACATTTCTGAAGGATTCTCGAGAATCCTTCAGAAATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000026.1-873s1c1
Sequence:CCGGGCGATGCCATATAAGCGGAATCTCGAGATTCCGCTTATATGGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009634
ADSL MISSION shRNA Bacterial Glycerol Stock
adenylosuccinate lyase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009634.5-1064s21c1
Sequence:CCGGTCTCACTGCAGATACTATATTCTCGAGAATATAGTATCTGCAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009634.5-378s21c1
Sequence:CCGGGACAATACGGACCTGATTATTCTCGAGAATAATCAGGTCCGTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009634.5-1733s21c1
Sequence:CCGGCCTGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009634.5-98s21c1
Sequence:CCGGCCGCGAGATGTGTTTCTTGTTCTCGAGAACAAGAAACACATCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-388s1c1
Sequence:CCGGGACCTGATTATTCTGAGAAATCTCGAGATTTCTCAGAATAATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-365s1c1
Sequence:CCGGCCTGCTATGTCGGAGACAATACTCGAGTATTGTCTCCGACATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009634.3-1739s1c1
Sequence:CCGGCCTGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-99s1c1
Sequence:CCGGCCGCGAGATGTGTTTCTTGTTCTCGAGAACAAGAAACACATCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-386s1c1
Sequence:CCGGCGGACCTGATTATTCTGAGAACTCGAGTTCTCAGAATAATCAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009634
ADSL MISSION shRNA shRNA Plasmid DNA
adenylosuccinate lyase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009634.5-1064s21c1
Sequence:CCGGTCTCACTGCAGATACTATATTCTCGAGAATATAGTATCTGCAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009634.5-378s21c1
Sequence:CCGGGACAATACGGACCTGATTATTCTCGAGAATAATCAGGTCCGTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009634.5-1733s21c1
Sequence:CCGGCCTGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009634.5-98s21c1
Sequence:CCGGCCGCGAGATGTGTTTCTTGTTCTCGAGAACAAGAAACACATCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-388s1c1
Sequence:CCGGGACCTGATTATTCTGAGAAATCTCGAGATTTCTCAGAATAATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-365s1c1
Sequence:CCGGCCTGCTATGTCGGAGACAATACTCGAGTATTGTCTCCGACATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009634.3-1739s1c1
Sequence:CCGGCCTGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-99s1c1
Sequence:CCGGCCGCGAGATGTGTTTCTTGTTCTCGAGAACAAGAAACACATCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-386s1c1
Sequence:CCGGCGGACCTGATTATTCTGAGAACTCGAGTTCTCAGAATAATCAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009634
ADSL MISSION shRNA Lentiviral Transduction Particles
adenylosuccinate lyase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009634.5-1064s21c1
Sequence:CCGGTCTCACTGCAGATACTATATTCTCGAGAATATAGTATCTGCAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009634.5-378s21c1
Sequence:CCGGGACAATACGGACCTGATTATTCTCGAGAATAATCAGGTCCGTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009634.5-1733s21c1
Sequence:CCGGCCTGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009634.5-98s21c1
Sequence:CCGGCCGCGAGATGTGTTTCTTGTTCTCGAGAACAAGAAACACATCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-388s1c1
Sequence:CCGGGACCTGATTATTCTGAGAAATCTCGAGATTTCTCAGAATAATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-365s1c1
Sequence:CCGGCCTGCTATGTCGGAGACAATACTCGAGTATTGTCTCCGACATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009634.3-1739s1c1
Sequence:CCGGCCTGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-99s1c1
Sequence:CCGGCCGCGAGATGTGTTTCTTGTTCTCGAGAACAAGAAACACATCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009634.3-386s1c1
Sequence:CCGGCGGACCTGATTATTCTGAGAACTCGAGTTCTCAGAATAATCAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks