EMAIL THIS PAGE TO A FRIEND

ADSSL1

adenylosuccinate synthase like 1

67 Gene Product Result for
UniProtKB ID: Q8N142, Q86TT6, Q8N714
Gene ID:
Human(122622) Summary: ADSSL1 is a muscle isozyme of adenylosuccinate synthase (EC 6.3.4.4), which catalyzes the initial reaction in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP) (Sun et al., 2005 [PubMed 15786719]
Mouse(11565) adenylosuccinate synthetase like 1
Rat(684425) adenylosuccinate synthase like 1
Zebrafish(407989) adenylosuccinate synthase like 1
cow(784089) adenylosuccinate synthase like 1
Horse(100061064) adenylosuccinate synthase like 1
chicken(776127) adenylosuccinate synthase like 1
dog(612692) adenylosuccinate synthase like 1
domestic cat(101087673) adenylosuccinate synthase like 1
naked mole-rat(101702121) adenylosuccinate synthase like 1
domestic guinea pig(100713988) adenylosuccinate synthase like 1
sheep(101103928) adenylosuccinate synthase like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152328 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152328 Rosetta Predictions human pricing
NM_199165 Rosetta Predictions human pricing
XM_001072835 Rosetta Predictions rat pricing
XM_001072867 Rosetta Predictions rat pricing
NM_007421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204949 predicted 730
2 SASI_Hs01_00204950 predicted 569
3 SASI_Hs01_00204953 predicted 765
4 SASI_Hs01_00204954 predicted 1094
5 SASI_Hs01_00204955 predicted 1261
6 SASI_Hs02_00365923 predicted 767
7 SASI_Hs02_00365924 predicted 1399
8 SASI_Hs01_00204956 predicted 1256
9 SASI_Hs01_00204957 predicted 1109
10 SASI_Hs02_00365925 predicted 1196
11 SASI_Hs01_00204948 predicted 575
12 SASI_Hs01_00204951 predicted 959
13 SASI_Hs01_00204952 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013045 predicted 787
2 SASI_Hs01_00013046 predicted 625
3 SASI_Hs01_00013049 predicted 830
4 SASI_Hs01_00013050 predicted 1149
5 SASI_Hs01_00013051 predicted 1317
6 SASI_Hs02_00372594 predicted 821
7 SASI_Hs02_00372595 predicted 1452
8 SASI_Hs01_00013052 predicted 1316
9 SASI_Hs01_00013053 predicted 1164
10 SASI_Hs02_00372596 predicted 1251
11 SASI_Hs01_00013044 predicted 634
12 SASI_Hs01_00013047 predicted 1018
13 SASI_Hs01_00013048 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340620 predicted 774
2 SASI_Rn02_00340621 predicted 365
3 SASI_Rn02_00340622 predicted 355
4 SASI_Rn02_00340623 predicted 468
5 SASI_Rn02_00340624 predicted 1000
6 SASI_Rn02_00340625 predicted 619
7 SASI_Rn02_00340626 predicted 305
8 SASI_Rn02_00340627 predicted 382
9 SASI_Rn02_00340628 predicted 573
10 SASI_Rn02_00340629 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340713 predicted 1204
2 SASI_Rn02_00340714 predicted 1418
3 SASI_Rn02_00340715 predicted 350
4 SASI_Rn02_00340716 predicted 466
5 SASI_Rn02_00340717 predicted 1240
6 SASI_Rn02_00340718 predicted 1524
7 SASI_Rn02_00340719 predicted 1146
8 SASI_Rn02_00340720 predicted 614
9 SASI_Rn02_00340721 predicted 303
10 SASI_Rn02_00340722 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197550 predicted 726
2 SASI_Mm01_00197551 predicted 614
3 SASI_Mm01_00197552 predicted 1107
4 SASI_Mm01_00197553 predicted 934
5 SASI_Mm01_00197554 predicted 1004
6 SASI_Mm01_00197555 predicted 872
7 SASI_Mm01_00197556 predicted 948
8 SASI_Mm01_00197557 predicted 381
9 SASI_Mm01_00197558 predicted 561
10 SASI_Mm01_00197559 predicted 1151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007421
ADSSL1 MISSION shRNA Bacterial Glycerol Stock
adenylosuccinate synthase like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-298s21c1
Sequence:CCGGGACGGCAAGGAGTATGACTTTCTCGAGAAAGTCATACTCCTTGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-709s21c1
Sequence:CCGGGATGTGGAAGGTCAACTCAAACTCGAGTTTGAGTTGACCTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-1262s21c1
Sequence:CCGGAGAAGGTGGAGGTCGAGTATGCTCGAGCATACTCGACCTCCACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-1174s21c1
Sequence:CCGGGATGTCCTGAGCGAGATTAAACTCGAGTTTAATCTCGCTCAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007421.1-1497s1c1
Sequence:CCGGCGAAACAGTCTGAAGCTATTTCTCGAGAAATAGCTTCAGACTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-1327s1c1
Sequence:CCGGGTGGAGAATCACATGGGTGTTCTCGAGAACACCCATGTGATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-905s1c1
Sequence:CCGGGCGATGTGTATGGTGTGGTAACTCGAGTTACCACACCATACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-1072s1c1
Sequence:CCGGCGATACGCTCACATGGTCAATCTCGAGATTGACCATGTGAGCGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-1176s1c1
Sequence:CCGGCGGAAAGAGGATTCCCTACTTCTCGAGAAGTAGGGAATCCTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007421
ADSSL1 MISSION shRNA shRNA Plasmid DNA
adenylosuccinate synthase like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-298s21c1
Sequence:CCGGGACGGCAAGGAGTATGACTTTCTCGAGAAAGTCATACTCCTTGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-709s21c1
Sequence:CCGGGATGTGGAAGGTCAACTCAAACTCGAGTTTGAGTTGACCTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-1262s21c1
Sequence:CCGGAGAAGGTGGAGGTCGAGTATGCTCGAGCATACTCGACCTCCACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-1174s21c1
Sequence:CCGGGATGTCCTGAGCGAGATTAAACTCGAGTTTAATCTCGCTCAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007421.1-1497s1c1
Sequence:CCGGCGAAACAGTCTGAAGCTATTTCTCGAGAAATAGCTTCAGACTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-1327s1c1
Sequence:CCGGGTGGAGAATCACATGGGTGTTCTCGAGAACACCCATGTGATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-905s1c1
Sequence:CCGGGCGATGTGTATGGTGTGGTAACTCGAGTTACCACACCATACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-1072s1c1
Sequence:CCGGCGATACGCTCACATGGTCAATCTCGAGATTGACCATGTGAGCGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-1176s1c1
Sequence:CCGGCGGAAAGAGGATTCCCTACTTCTCGAGAAGTAGGGAATCCTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007421
ADSSL1 MISSION shRNA Lentiviral Transduction Particles
adenylosuccinate synthase like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-298s21c1
Sequence:CCGGGACGGCAAGGAGTATGACTTTCTCGAGAAAGTCATACTCCTTGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-709s21c1
Sequence:CCGGGATGTGGAAGGTCAACTCAAACTCGAGTTTGAGTTGACCTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-1262s21c1
Sequence:CCGGAGAAGGTGGAGGTCGAGTATGCTCGAGCATACTCGACCTCCACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007421.2-1174s21c1
Sequence:CCGGGATGTCCTGAGCGAGATTAAACTCGAGTTTAATCTCGCTCAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007421.1-1497s1c1
Sequence:CCGGCGAAACAGTCTGAAGCTATTTCTCGAGAAATAGCTTCAGACTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-1327s1c1
Sequence:CCGGGTGGAGAATCACATGGGTGTTCTCGAGAACACCCATGTGATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-905s1c1
Sequence:CCGGGCGATGTGTATGGTGTGGTAACTCGAGTTACCACACCATACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-1072s1c1
Sequence:CCGGCGATACGCTCACATGGTCAATCTCGAGATTGACCATGTGAGCGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007421.1-1176s1c1
Sequence:CCGGCGGAAAGAGGATTCCCTACTTCTCGAGAAGTAGGGAATCCTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152328
ADSSL1 MISSION shRNA Bacterial Glycerol Stock
adenylosuccinate synthase like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152328.3-1586s21c1
Sequence:CCGGTGTTGGTTTCTACAATGATTTCTCGAGAAATCATTGTAGAAACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-1176s21c1
Sequence:CCGGGACGTACTGGGTGAGGTTAAACTCGAGTTTAACCTCACCCAGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-1009s21c1
Sequence:CCGGCCGAGCAGATCAACGAGATTGCTCGAGCAATCTCGTTGATCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-940s21c1
Sequence:CCGGAGAACATAGGTGACGTGTATGCTCGAGCATACACGTCACCTATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-1381s21c1
Sequence:CCGGACGTGGGAGTCGCAGTCAAATCTCGAGATTTGACTGCGACTCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-1199s1c1
Sequence:CCGGCGGTGTCTCATACAAGCTGAACTCGAGTTCAGCTTGTATGAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-472s1c1
Sequence:CCGGGAGCCCACCTTGTGTTTGATTCTCGAGAATCAAACACAAGGTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-699s1c1
Sequence:CCGGACCCTGGAAATAGACATTGAACTCGAGTTCAATGTCTATTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-1100s1c1
Sequence:CCGGCGACCTGATGATTCTAAGATACTCGAGTATCTTAGAATCATCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-1267s1c1
Sequence:CCGGAGGTCGAAGTTGAGTATGAAACTCGAGTTTCATACTCAACTTCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152328
ADSSL1 MISSION shRNA shRNA Plasmid DNA
adenylosuccinate synthase like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152328.3-1586s21c1
Sequence:CCGGTGTTGGTTTCTACAATGATTTCTCGAGAAATCATTGTAGAAACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-1176s21c1
Sequence:CCGGGACGTACTGGGTGAGGTTAAACTCGAGTTTAACCTCACCCAGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-1009s21c1
Sequence:CCGGCCGAGCAGATCAACGAGATTGCTCGAGCAATCTCGTTGATCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-940s21c1
Sequence:CCGGAGAACATAGGTGACGTGTATGCTCGAGCATACACGTCACCTATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-1381s21c1
Sequence:CCGGACGTGGGAGTCGCAGTCAAATCTCGAGATTTGACTGCGACTCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-1199s1c1
Sequence:CCGGCGGTGTCTCATACAAGCTGAACTCGAGTTCAGCTTGTATGAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-472s1c1
Sequence:CCGGGAGCCCACCTTGTGTTTGATTCTCGAGAATCAAACACAAGGTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-699s1c1
Sequence:CCGGACCCTGGAAATAGACATTGAACTCGAGTTCAATGTCTATTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-1100s1c1
Sequence:CCGGCGACCTGATGATTCTAAGATACTCGAGTATCTTAGAATCATCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-1267s1c1
Sequence:CCGGAGGTCGAAGTTGAGTATGAAACTCGAGTTTCATACTCAACTTCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152328
ADSSL1 MISSION shRNA Lentiviral Transduction Particles
adenylosuccinate synthase like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152328.3-1586s21c1
Sequence:CCGGTGTTGGTTTCTACAATGATTTCTCGAGAAATCATTGTAGAAACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-1176s21c1
Sequence:CCGGGACGTACTGGGTGAGGTTAAACTCGAGTTTAACCTCACCCAGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-1009s21c1
Sequence:CCGGCCGAGCAGATCAACGAGATTGCTCGAGCAATCTCGTTGATCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-940s21c1
Sequence:CCGGAGAACATAGGTGACGTGTATGCTCGAGCATACACGTCACCTATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152328.3-1381s21c1
Sequence:CCGGACGTGGGAGTCGCAGTCAAATCTCGAGATTTGACTGCGACTCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-1199s1c1
Sequence:CCGGCGGTGTCTCATACAAGCTGAACTCGAGTTCAGCTTGTATGAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-472s1c1
Sequence:CCGGGAGCCCACCTTGTGTTTGATTCTCGAGAATCAAACACAAGGTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-699s1c1
Sequence:CCGGACCCTGGAAATAGACATTGAACTCGAGTTCAATGTCTATTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-1100s1c1
Sequence:CCGGCGACCTGATGATTCTAAGATACTCGAGTATCTTAGAATCATCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152328.3-1267s1c1
Sequence:CCGGAGGTCGAAGTTGAGTATGAAACTCGAGTTTCATACTCAACTTCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks