EMAIL THIS PAGE TO A FRIEND

ADTRP

androgen-dependent TFPI-regulating protein

71 Gene Product Result for
Synonyms: AIG1L C6orf105 dJ413H6.1
UniProtKB ID: Q96IZ2, B2R7T9, B4DV39, Q5THW1
Gene ID:
Mouse(109254) androgen dependent TFPI regulating protein
Rat(361228) androgen-dependent TFPI-regulating protein
cow(613714) androgen-dependent TFPI-regulating protein
domestic cat(101090938) androgen-dependent TFPI-regulating protein
dog(478722) androgen-dependent TFPI-regulating protein
sheep(101105035) androgen-dependent TFPI-regulating protein
domestic guinea pig(100724926) androgen-dependent TFPI-regulating protein
naked mole-rat(101696489) androgen-dependent TFPI-regulating protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032744 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU068331 MISSION® esiRNA esiRNA targeting mouse 9530008L14Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032744 Rosetta Predictions human pricing
NM_001014144 Rosetta Predictions rat pricing
NM_175417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360294 predicted 583
2 SASI_Hs01_00144528 predicted 507
3 SASI_Hs01_00144530 predicted 348
4 SASI_Hs01_00144532 predicted 505
5 SASI_Hs01_00144533 predicted 536
6 SASI_Hs01_00144535 predicted 453
7 SASI_Hs01_00144536 predicted 372
8 SASI_Hs01_00144537 predicted 447
9 SASI_Hs02_00360295 predicted 219
10 SASI_Hs02_00360296 predicted 484
11 SASI_Hs01_00144529 predicted 308
12 SASI_Hs01_00144531 predicted 449
13 SASI_Hs01_00144534 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040449 predicted 390
2 SASI_Rn01_00040451 predicted 480
3 SASI_Rn01_00040452 predicted 322
4 SASI_Rn01_00040453 predicted 390
5 SASI_Rn02_00201604 predicted 547
6 SASI_Rn01_00040454 predicted 788
7 SASI_Rn01_00040455 predicted 484
8 SASI_Rn01_00040456 predicted 389
9 SASI_Rn01_00040457 predicted 498
10 SASI_Rn01_00040458 predicted 232
11 SASI_Rn01_00040450 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021002 predicted 422
2 SASI_Mm02_00346291 predicted 350
3 SASI_Mm01_00021006 predicted 511
4 SASI_Mm01_00021007 predicted 653
5 SASI_Mm01_00021008 predicted 520
6 SASI_Mm01_00021009 predicted 434
7 SASI_Mm01_00021010 predicted 505
8 SASI_Mm02_00346292 predicted 382
9 SASI_Mm01_00021011 predicted 259
10 SASI_Mm02_00346293 predicted 634
11 SASI_Mm01_00021003 predicted 419
12 SASI_Mm01_00021004 predicted 418
13 SASI_Mm01_00021005 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175417
VALIDATED
ADTRP MISSION shRNA Bacterial Glycerol Stock
androgen-dependent TFPI-regulating protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175417.2-1320s1c1
Sequence:CCGGGCAGAGTAAGACCCTGTCATTCTCGAGAATGACAGGGTCTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175417.2-208s1c1
Sequence:CCGGCATCCCACAGATTGGAAGGAACTCGAGTTCCTTCCAATCTGTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175417.2-799s1c1
Sequence:CCGGTGCCATAGCAAAGCCACAGATCTCGAGATCTGTGGCTTTGCTATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175417.2-706s1c1
Sequence:CCGGCCCACTGGGTATTATCATCTTCTCGAGAAGATGATAATACCCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175417.2-523s1c1
Sequence:CCGGCGCAATGCATACCTCCATATTCTCGAGAATATGGAGGTATGCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175417.4-437s21c1
Sequence:CCGGGGTATTCTGGACTCTCTTTCACTCGAGTGAAAGAGAGTCCAGAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175417.4-348s21c1
Sequence:CCGGATCGGAAGGAAAGACATCAAGCTCGAGCTTGATGTCTTTCCTTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175417
VALIDATED
ADTRP MISSION shRNA shRNA Plasmid DNA
androgen-dependent TFPI-regulating protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175417.2-1320s1c1
Sequence:CCGGGCAGAGTAAGACCCTGTCATTCTCGAGAATGACAGGGTCTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175417.2-208s1c1
Sequence:CCGGCATCCCACAGATTGGAAGGAACTCGAGTTCCTTCCAATCTGTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175417.2-799s1c1
Sequence:CCGGTGCCATAGCAAAGCCACAGATCTCGAGATCTGTGGCTTTGCTATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175417.2-706s1c1
Sequence:CCGGCCCACTGGGTATTATCATCTTCTCGAGAAGATGATAATACCCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175417.2-523s1c1
Sequence:CCGGCGCAATGCATACCTCCATATTCTCGAGAATATGGAGGTATGCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175417.4-437s21c1
Sequence:CCGGGGTATTCTGGACTCTCTTTCACTCGAGTGAAAGAGAGTCCAGAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175417.4-348s21c1
Sequence:CCGGATCGGAAGGAAAGACATCAAGCTCGAGCTTGATGTCTTTCCTTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175417
VALIDATED
ADTRP MISSION shRNA Lentiviral Transduction Particles
androgen-dependent TFPI-regulating protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175417.2-1320s1c1
Sequence:CCGGGCAGAGTAAGACCCTGTCATTCTCGAGAATGACAGGGTCTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175417.2-208s1c1
Sequence:CCGGCATCCCACAGATTGGAAGGAACTCGAGTTCCTTCCAATCTGTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175417.2-799s1c1
Sequence:CCGGTGCCATAGCAAAGCCACAGATCTCGAGATCTGTGGCTTTGCTATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175417.2-706s1c1
Sequence:CCGGCCCACTGGGTATTATCATCTTCTCGAGAAGATGATAATACCCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175417.2-523s1c1
Sequence:CCGGCGCAATGCATACCTCCATATTCTCGAGAATATGGAGGTATGCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175417.4-437s21c1
Sequence:CCGGGGTATTCTGGACTCTCTTTCACTCGAGTGAAAGAGAGTCCAGAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175417.4-348s21c1
Sequence:CCGGATCGGAAGGAAAGACATCAAGCTCGAGCTTGATGTCTTTCCTTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032744
ADTRP MISSION shRNA Bacterial Glycerol Stock
androgen-dependent TFPI-regulating protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032744.1-1297s1c1
Sequence:CCGGGCATTTCAGTAAGCTAGTTATCTCGAGATAACTAGCTTACTGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-118s1c1
Sequence:CCGGGCTGGTATACTTTCCTCAATTCTCGAGAATTGAGGAAAGTATACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-509s1c1
Sequence:CCGGGCCTCACTCCTATCCATCAAACTCGAGTTTGATGGATAGGAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-746s1c1
Sequence:CCGGGCCACGGAAGAAGAGGAAGTACTCGAGTACTTCCTCTTCTTCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-563s1c1
Sequence:CCGGCATTGCTTACATCAGCCGCATCTCGAGATGCGGCTGATGTAAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032744.3-1311s21c1
Sequence:CCGGAGGAACTTAGAGTCATTTAAACTCGAGTTTAAATGACTCTAAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032744.3-673s21c1
Sequence:CCGGGCAATGCACACTTTCATATTCCTCGAGGAATATGAAAGTGTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032744.3-608s21c1
Sequence:CCGGTCTACAATCGAGATCTCATTTCTCGAGAAATGAGATCTCGATTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032744
ADTRP MISSION shRNA shRNA Plasmid DNA
androgen-dependent TFPI-regulating protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032744.1-1297s1c1
Sequence:CCGGGCATTTCAGTAAGCTAGTTATCTCGAGATAACTAGCTTACTGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-118s1c1
Sequence:CCGGGCTGGTATACTTTCCTCAATTCTCGAGAATTGAGGAAAGTATACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-509s1c1
Sequence:CCGGGCCTCACTCCTATCCATCAAACTCGAGTTTGATGGATAGGAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-746s1c1
Sequence:CCGGGCCACGGAAGAAGAGGAAGTACTCGAGTACTTCCTCTTCTTCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-563s1c1
Sequence:CCGGCATTGCTTACATCAGCCGCATCTCGAGATGCGGCTGATGTAAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032744.3-1311s21c1
Sequence:CCGGAGGAACTTAGAGTCATTTAAACTCGAGTTTAAATGACTCTAAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032744.3-673s21c1
Sequence:CCGGGCAATGCACACTTTCATATTCCTCGAGGAATATGAAAGTGTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032744.3-608s21c1
Sequence:CCGGTCTACAATCGAGATCTCATTTCTCGAGAAATGAGATCTCGATTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032744
ADTRP MISSION shRNA Lentiviral Transduction Particles
androgen-dependent TFPI-regulating protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032744.1-1297s1c1
Sequence:CCGGGCATTTCAGTAAGCTAGTTATCTCGAGATAACTAGCTTACTGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-118s1c1
Sequence:CCGGGCTGGTATACTTTCCTCAATTCTCGAGAATTGAGGAAAGTATACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-509s1c1
Sequence:CCGGGCCTCACTCCTATCCATCAAACTCGAGTTTGATGGATAGGAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-746s1c1
Sequence:CCGGGCCACGGAAGAAGAGGAAGTACTCGAGTACTTCCTCTTCTTCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032744.1-563s1c1
Sequence:CCGGCATTGCTTACATCAGCCGCATCTCGAGATGCGGCTGATGTAAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032744.3-1311s21c1
Sequence:CCGGAGGAACTTAGAGTCATTTAAACTCGAGTTTAAATGACTCTAAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032744.3-673s21c1
Sequence:CCGGGCAATGCACACTTTCATATTCCTCGAGGAATATGAAAGTGTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032744.3-608s21c1
Sequence:CCGGTCTACAATCGAGATCTCATTTCTCGAGAAATGAGATCTCGATTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks