EMAIL THIS PAGE TO A FRIEND

AEBP1

AE binding protein 1

53 Gene Product Result for
Synonyms: ACLP
UniProtKB ID: Q8IUX7, Q14113, Q59ER7, Q6ZSC7, Q7KZ79
Gene ID:
Human(165) Summary: This gene encodes a member of carboxypeptidase A protein family. The encoded protein may function as a transcriptional repressor and play a role in adipogenesis and smooth muscle cell differentiation. Studies in mice suggest that this gene functions in wound healing and abdominal wall development. Overexpression of this gene is associated with glioblastoma. [provided by RefSeq, May 2013]
Mouse(11568) AE binding protein 1
Rat(305494) AE binding protein 1
sheep(101119132) AE binding protein 1
naked mole-rat(101722619) AE binding protein 1
domestic guinea pig(100728117) AE binding protein 1
Zebrafish(323670) AE binding protein 1
cow(317693) AE binding protein 1
domestic cat(101098365) AE binding protein 1
dog(608927) AE binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001129 Rosetta Predictions human pricing
NM_001100970 Rosetta Predictions rat pricing
NM_009636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050742 predicted 2934
2 SASI_Hs01_00050743 predicted 3121
3 SASI_Hs01_00050744 predicted 2872
4 SASI_Hs01_00050745 predicted 1757
5 SASI_Hs01_00050746 predicted 1852
6 SASI_Hs01_00050747 predicted 3085
7 SASI_Hs01_00050748 predicted 1773
8 SASI_Hs02_00331216 predicted 1356
9 SASI_Hs01_00050749 predicted 2618
10 SASI_Hs01_00050750 predicted 1993
11 SASI_Hs01_00050751 predicted 2307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210842 predicted 2330
2 SASI_Rn02_00210843 predicted 2399
3 SASI_Rn02_00210844 predicted 1620
4 SASI_Rn02_00210845 predicted 2430
5 SASI_Rn02_00210846 predicted 2261
6 SASI_Rn02_00210847 predicted 2735
7 SASI_Rn02_00210848 predicted 1142
8 SASI_Rn02_00210849 predicted 892
9 SASI_Rn02_00210850 predicted 2978
10 SASI_Rn02_00210851 predicted 2948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132062 predicted 2870
2 SASI_Mm01_00132063 predicted 1524
3 SASI_Mm01_00132064 predicted 2517
4 SASI_Mm01_00132065 predicted 2426
5 SASI_Mm01_00132066 predicted 2975
6 SASI_Mm01_00132067 predicted 2826
7 SASI_Mm02_00316599 predicted 1232
8 SASI_Mm01_00132068 predicted 1184
9 SASI_Mm02_00316600 predicted 2341
10 SASI_Mm02_00316601 predicted 2911
11 SASI_Mm01_00132069 predicted 798
12 SASI_Mm01_00132070 predicted 1660
13 SASI_Mm01_00132071 predicted 1811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009636
VALIDATED
AEBP1 MISSION shRNA Bacterial Glycerol Stock
AE binding protein 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009636.2-3875s21c1
Sequence:CCGGAGCCAACGTCACATCAATAAACTCGAGTTTATTGATGTGACGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-1663s21c1
Sequence:CCGGCGACTTCGTGACTACCTTCTTCTCGAGAAGAAGGTAGTCACGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-2673s21c1
Sequence:CCGGAGACTCCAGATCACGCTATTTCTCGAGAAATAGCGTGATCTGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-1723s21c1
Sequence:CCGGCACCAATGGCTACGAGGAAATCTCGAGATTTCCTCGTAGCCATTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-3158s21c1
Sequence:CCGGTGCAATGTGGACTACGATATTCTCGAGAATATCGTAGTCCACATTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1975s1c1
Sequence:CCGGCGCAATGGAAATCTCAGACAACTCGAGTTGTCTGAGATTTCCATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009636.1-687s1c1
Sequence:CCGGCGGCAGGAAAGAAGTTCTCAACTCGAGTTGAGAACTTCTTTCCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-3253s1c1
Sequence:CCGGGCTCCGCATGAGGGAACAGATCTCGAGATCTGTTCCCTCATGCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1442s1c1
Sequence:CCGGGCCAATGAAGATGACTACTATCTCGAGATAGTAGTCATCTTCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-2092s1c1
Sequence:CCGGGCAATACCTATGCCAGGAGTACTCGAGTACTCCTGGCATAGGTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1724s1c1
Sequence:CCGGGCCCGTTTCATCCGCATCTATCTCGAGATAGATGCGGATGAAACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-2840s1c1
Sequence:CCGGGAATGGGAGAACAACAAAGAACTCGAGTTCTTTGTTGTTCTCCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1102s1c1
Sequence:CCGGCTATGATGACTTGGACTATTACTCGAGTAATAGTCCAAGTCATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-3443s1c1
Sequence:CCGGACAGAGTTTGAGACAGAGTATCTCGAGATACTCTGTCTCAAACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1579s1c1
Sequence:CCGGCGACTTCGTGACTACCTTCTTCTCGAGAAGAAGGTAGTCACGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009636
VALIDATED
AEBP1 MISSION shRNA shRNA Plasmid DNA
AE binding protein 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009636.2-3875s21c1
Sequence:CCGGAGCCAACGTCACATCAATAAACTCGAGTTTATTGATGTGACGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-1663s21c1
Sequence:CCGGCGACTTCGTGACTACCTTCTTCTCGAGAAGAAGGTAGTCACGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-2673s21c1
Sequence:CCGGAGACTCCAGATCACGCTATTTCTCGAGAAATAGCGTGATCTGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-1723s21c1
Sequence:CCGGCACCAATGGCTACGAGGAAATCTCGAGATTTCCTCGTAGCCATTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-3158s21c1
Sequence:CCGGTGCAATGTGGACTACGATATTCTCGAGAATATCGTAGTCCACATTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1975s1c1
Sequence:CCGGCGCAATGGAAATCTCAGACAACTCGAGTTGTCTGAGATTTCCATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009636.1-687s1c1
Sequence:CCGGCGGCAGGAAAGAAGTTCTCAACTCGAGTTGAGAACTTCTTTCCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-3253s1c1
Sequence:CCGGGCTCCGCATGAGGGAACAGATCTCGAGATCTGTTCCCTCATGCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1442s1c1
Sequence:CCGGGCCAATGAAGATGACTACTATCTCGAGATAGTAGTCATCTTCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-2092s1c1
Sequence:CCGGGCAATACCTATGCCAGGAGTACTCGAGTACTCCTGGCATAGGTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1724s1c1
Sequence:CCGGGCCCGTTTCATCCGCATCTATCTCGAGATAGATGCGGATGAAACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-2840s1c1
Sequence:CCGGGAATGGGAGAACAACAAAGAACTCGAGTTCTTTGTTGTTCTCCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1102s1c1
Sequence:CCGGCTATGATGACTTGGACTATTACTCGAGTAATAGTCCAAGTCATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-3443s1c1
Sequence:CCGGACAGAGTTTGAGACAGAGTATCTCGAGATACTCTGTCTCAAACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1579s1c1
Sequence:CCGGCGACTTCGTGACTACCTTCTTCTCGAGAAGAAGGTAGTCACGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009636
VALIDATED
AEBP1 MISSION shRNA Lentiviral Transduction Particles
AE binding protein 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009636.2-3875s21c1
Sequence:CCGGAGCCAACGTCACATCAATAAACTCGAGTTTATTGATGTGACGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-1663s21c1
Sequence:CCGGCGACTTCGTGACTACCTTCTTCTCGAGAAGAAGGTAGTCACGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-2673s21c1
Sequence:CCGGAGACTCCAGATCACGCTATTTCTCGAGAAATAGCGTGATCTGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-1723s21c1
Sequence:CCGGCACCAATGGCTACGAGGAAATCTCGAGATTTCCTCGTAGCCATTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009636.2-3158s21c1
Sequence:CCGGTGCAATGTGGACTACGATATTCTCGAGAATATCGTAGTCCACATTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1975s1c1
Sequence:CCGGCGCAATGGAAATCTCAGACAACTCGAGTTGTCTGAGATTTCCATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009636.1-687s1c1
Sequence:CCGGCGGCAGGAAAGAAGTTCTCAACTCGAGTTGAGAACTTCTTTCCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-3253s1c1
Sequence:CCGGGCTCCGCATGAGGGAACAGATCTCGAGATCTGTTCCCTCATGCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1442s1c1
Sequence:CCGGGCCAATGAAGATGACTACTATCTCGAGATAGTAGTCATCTTCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-2092s1c1
Sequence:CCGGGCAATACCTATGCCAGGAGTACTCGAGTACTCCTGGCATAGGTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1724s1c1
Sequence:CCGGGCCCGTTTCATCCGCATCTATCTCGAGATAGATGCGGATGAAACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-2840s1c1
Sequence:CCGGGAATGGGAGAACAACAAAGAACTCGAGTTCTTTGTTGTTCTCCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1102s1c1
Sequence:CCGGCTATGATGACTTGGACTATTACTCGAGTAATAGTCCAAGTCATCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-3443s1c1
Sequence:CCGGACAGAGTTTGAGACAGAGTATCTCGAGATACTCTGTCTCAAACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009636.1-1579s1c1
Sequence:CCGGCGACTTCGTGACTACCTTCTTCTCGAGAAGAAGGTAGTCACGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129
VALIDATED
AEBP1 MISSION shRNA Bacterial Glycerol Stock
AE binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-3936s21c1
Sequence:CCGGCAAACATGACTGGGACCTAAGCTCGAGCTTAGGTCCCAGTCATGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-2086s21c1
Sequence:CCGGCACGAGGCCTCAAGATCTATGCTCGAGCATAGATCTTGAGGCCTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-1470s21c1
Sequence:CCGGGGGATGGAGTCACACCGTATTCTCGAGAATACGGTGTGACTCCATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-1236s21c1
Sequence:CCGGTACGATGACATGGACTATTACCTCGAGGTAATAGTCCATGTCATCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-1018s21c1
Sequence:CCGGAGATCGAGAGGGAGGACTATGCTCGAGCATAGTCCTCCCTCTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001129.2-2701s1c1
Sequence:CCGGGACCGGGACTATCAATGACTTCTCGAGAAGTCATTGATAGTCCCGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001129.2-741s1c1
Sequence:CCGGCCCTCTCAAATAACTGGCAGACTCGAGTCTGCCAGTTATTTGAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001129.2-1774s1c1
Sequence:CCGGCTACAGCTACTACGCACAGAACTCGAGTTCTGTGCGTAGTAGCTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001129.2-1072s1c1
Sequence:CCGGCGATGACATGGACTATTACTTCTCGAGAAGTAATAGTCCATGTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001129.2-2953s1c1
Sequence:CCGGTGGTGGTGATTACTGGCGAATCTCGAGATTCGCCAGTAATCACCACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129
VALIDATED
AEBP1 MISSION shRNA shRNA Plasmid DNA
AE binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-3936s21c1
Sequence:CCGGCAAACATGACTGGGACCTAAGCTCGAGCTTAGGTCCCAGTCATGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-2086s21c1
Sequence:CCGGCACGAGGCCTCAAGATCTATGCTCGAGCATAGATCTTGAGGCCTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-1470s21c1
Sequence:CCGGGGGATGGAGTCACACCGTATTCTCGAGAATACGGTGTGACTCCATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-1236s21c1
Sequence:CCGGTACGATGACATGGACTATTACCTCGAGGTAATAGTCCATGTCATCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-1018s21c1
Sequence:CCGGAGATCGAGAGGGAGGACTATGCTCGAGCATAGTCCTCCCTCTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001129.2-2701s1c1
Sequence:CCGGGACCGGGACTATCAATGACTTCTCGAGAAGTCATTGATAGTCCCGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001129.2-741s1c1
Sequence:CCGGCCCTCTCAAATAACTGGCAGACTCGAGTCTGCCAGTTATTTGAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001129.2-1774s1c1
Sequence:CCGGCTACAGCTACTACGCACAGAACTCGAGTTCTGTGCGTAGTAGCTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001129.2-1072s1c1
Sequence:CCGGCGATGACATGGACTATTACTTCTCGAGAAGTAATAGTCCATGTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001129.2-2953s1c1
Sequence:CCGGTGGTGGTGATTACTGGCGAATCTCGAGATTCGCCAGTAATCACCACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129
VALIDATED
AEBP1 MISSION shRNA Lentiviral Transduction Particles
AE binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-3936s21c1
Sequence:CCGGCAAACATGACTGGGACCTAAGCTCGAGCTTAGGTCCCAGTCATGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-2086s21c1
Sequence:CCGGCACGAGGCCTCAAGATCTATGCTCGAGCATAGATCTTGAGGCCTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-1470s21c1
Sequence:CCGGGGGATGGAGTCACACCGTATTCTCGAGAATACGGTGTGACTCCATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-1236s21c1
Sequence:CCGGTACGATGACATGGACTATTACCTCGAGGTAATAGTCCATGTCATCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001129.3-1018s21c1
Sequence:CCGGAGATCGAGAGGGAGGACTATGCTCGAGCATAGTCCTCCCTCTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001129.2-2701s1c1
Sequence:CCGGGACCGGGACTATCAATGACTTCTCGAGAAGTCATTGATAGTCCCGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001129.2-741s1c1
Sequence:CCGGCCCTCTCAAATAACTGGCAGACTCGAGTCTGCCAGTTATTTGAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001129.2-1774s1c1
Sequence:CCGGCTACAGCTACTACGCACAGAACTCGAGTTCTGTGCGTAGTAGCTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001129.2-1072s1c1
Sequence:CCGGCGATGACATGGACTATTACTTCTCGAGAAGTAATAGTCCATGTCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001129.2-2953s1c1
Sequence:CCGGTGGTGGTGATTACTGGCGAATCTCGAGATTCGCCAGTAATCACCACCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)