EMAIL THIS PAGE TO A FRIEND

AEBP2

AE binding protein 2

246 Gene Product Result for
UniProtKB ID: Q6ZN18, Q59FS5, Q6ZN62, Q96BG3
Gene ID:
Mouse(11569) AE binding protein 2
Rat(297705) AE binding protein 2
Zebrafish(406815) AE binding protein 2
chicken(418184) AE binding protein 2
cow(537791) AE binding protein 2
Horse(100067927) AE binding protein 2
domestic cat(101084800) AE binding protein 2
dog(486656) AE binding protein 2
domestic guinea pig(100717190) AE binding protein 2
naked mole-rat(101705878) AE binding protein 2
sheep(101121336) AE binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114176 Rosetta Predictions human pricing
NM_153207 Rosetta Predictions human pricing
NM_001106626 Rosetta Predictions rat pricing
NM_001005605 Rosetta Predictions mouse pricing
NM_009637 Rosetta Predictions mouse pricing
NM_178803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326444 predicted 844
2 SASI_Hs02_00326445 predicted 1239
3 SASI_Hs02_00326446 predicted 1229
4 SASI_Hs02_00326447 predicted 1246
5 SASI_Hs02_00326448 predicted 915
6 SASI_Hs02_00326449 predicted 1249
7 SASI_Hs02_00326450 predicted 1240
8 SASI_Hs02_00326451 predicted 916
9 SASI_Hs02_00326452 predicted 1217
10 SASI_Hs02_00326453 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189618 predicted 846
2 SASI_Hs01_00189619 predicted 1243
3 SASI_Hs02_00367052 predicted 1222
4 SASI_Hs01_00189620 predicted 1246
5 SASI_Hs01_00189621 predicted 911
6 SASI_Hs01_00189623 predicted 1243
7 SASI_Hs01_00189624 predicted 1236
8 SASI_Hs01_00189625 predicted 913
9 SASI_Hs01_00189626 predicted 1223
10 SASI_Hs02_00367053 predicted 1131
11 SASI_Hs01_00189622 predicted 903
12 SASI_Hs01_00189627 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220798 predicted 742
2 SASI_Rn02_00220799 predicted 822
3 SASI_Rn02_00220800 predicted 555
4 SASI_Rn02_00220801 predicted 944
5 SASI_Rn02_00220802 predicted 1019
6 SASI_Rn02_00220803 predicted 489
7 SASI_Rn02_00220804 predicted 696
8 SASI_Rn02_00220805 predicted 1027
9 SASI_Rn02_00220806 predicted 537
10 SASI_Rn02_00220807 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023092 predicted 1204
2 SASI_Mm02_00286638 predicted 1083
3 SASI_Mm01_00023094 predicted 1098
4 SASI_Mm01_00023095 predicted 953
5 SASI_Mm01_00023096 predicted 1016
6 SASI_Mm01_00023097 predicted 1185
7 SASI_Mm02_00286639 predicted 862
8 SASI_Mm01_00023098 predicted 1094
9 SASI_Mm01_00023099 predicted 1201
10 SASI_Mm01_00023100 predicted 962
11 SASI_Mm01_00023093 predicted 868
12 SASI_Mm01_00023101 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078831 predicted 588
2 SASI_Mm02_00316602 predicted 471
3 SASI_Mm01_00078833 predicted 489
4 SASI_Mm01_00078834 predicted 350
5 SASI_Mm01_00078835 predicted 410
6 SASI_Mm01_00078836 predicted 567
7 SASI_Mm02_00316603 predicted 257
8 SASI_Mm01_00078837 predicted 486
9 SASI_Mm01_00078838 predicted 591
10 SASI_Mm01_00078839 predicted 344
11 SASI_Mm01_00078832 predicted 258
12 SASI_Mm01_00078840 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153678 predicted 938
2 SASI_Mm02_00349408 predicted 821
3 SASI_Mm01_00153680 predicted 836
4 SASI_Mm01_00153681 predicted 691
5 SASI_Mm01_00153682 predicted 755
6 SASI_Mm01_00153683 predicted 916
7 SASI_Mm02_00349409 predicted 605
8 SASI_Mm01_00153684 predicted 838
9 SASI_Mm01_00153685 predicted 941
10 SASI_Mm01_00153686 predicted 697
11 SASI_Mm01_00153679 predicted 606
12 SASI_Mm01_00153687 predicted 993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153207
VALIDATED
AEBP2 MISSION shRNA Bacterial Glycerol Stock
AE binding protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153207.3-2442s1c1
Sequence:CCGGGCACCAAAGTTGGTCTTGAAACTCGAGTTTCAAGACCAACTTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-836s1c1
Sequence:CCGGGCAGATCACATCCGTTCCATACTCGAGTATGGAACGGATGTGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-1214s1c1
Sequence:CCGGGCGATAAGACATCGAGCCATACTCGAGTATGGCTCGATGTCTTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-1468s1c1
Sequence:CCGGCCCAAACATATACAGAACAATCTCGAGATTGTTCTGTATATGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-705s1c1
Sequence:CCGGCAATTTCCAGTGGGCGTTCAACTCGAGTTGAACGCCCACTGGAAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153207
VALIDATED
AEBP2 MISSION shRNA shRNA Plasmid DNA
AE binding protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153207.3-2442s1c1
Sequence:CCGGGCACCAAAGTTGGTCTTGAAACTCGAGTTTCAAGACCAACTTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-836s1c1
Sequence:CCGGGCAGATCACATCCGTTCCATACTCGAGTATGGAACGGATGTGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-1214s1c1
Sequence:CCGGGCGATAAGACATCGAGCCATACTCGAGTATGGCTCGATGTCTTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-1468s1c1
Sequence:CCGGCCCAAACATATACAGAACAATCTCGAGATTGTTCTGTATATGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-705s1c1
Sequence:CCGGCAATTTCCAGTGGGCGTTCAACTCGAGTTGAACGCCCACTGGAAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153207
VALIDATED
AEBP2 MISSION shRNA Lentiviral Transduction Particles
AE binding protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153207.3-2442s1c1
Sequence:CCGGGCACCAAAGTTGGTCTTGAAACTCGAGTTTCAAGACCAACTTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-836s1c1
Sequence:CCGGGCAGATCACATCCGTTCCATACTCGAGTATGGAACGGATGTGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-1214s1c1
Sequence:CCGGGCGATAAGACATCGAGCCATACTCGAGTATGGCTCGATGTCTTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-1468s1c1
Sequence:CCGGCCCAAACATATACAGAACAATCTCGAGATTGTTCTGTATATGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153207.3-705s1c1
Sequence:CCGGCAATTTCCAGTGGGCGTTCAACTCGAGTTGAACGCCCACTGGAAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005605
VALIDATED
AEBP2 MISSION shRNA Bacterial Glycerol Stock
AE binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-1422s1c1
Sequence:CCGGGCTACCCAAAGATACTGCCTTCTCGAGAAGGCAGTATCTTTGGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-654s1c1
Sequence:CCGGCAGCATAAGCAGTACGCTAATCTCGAGATTAGCGTACTGCTTATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005605.1-1822s1c1
Sequence:CCGGCCCTAGTGATTACAGTAGTTTCTCGAGAAACTACTGTAATCACTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-1123s1c1
Sequence:CCGGCGGAGGAAACTAAAGAACAAACTCGAGTTTGTTCTTTAGTTTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-1119s1c1
Sequence:CCGGCAAGCGGAGGAAACTAAAGAACTCGAGTTCTTTAGTTTCCTCCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-1119s21c1
Sequence:CCGGCAAGCGGAGGAAACTAAAGAACTCGAGTTCTTTAGTTTCCTCCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-751s21c1
Sequence:CCGGAGCAAACACATTGCCTATAACCTCGAGGTTATAGGCAATGTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005605.1-1617s21c1
Sequence:CCGGTCCAGTATTTAGAGTACTATTCTCGAGAATAGTACTCTAAATACTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-654s21c1
Sequence:CCGGCAGCATAAGCAGTACGCTAATCTCGAGATTAGCGTACTGCTTATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-882s21c1
Sequence:CCGGGAAAGGTTGCAAGGTGTATAACTCGAGTTATACACCTTGCAACCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005605
VALIDATED
AEBP2 MISSION shRNA shRNA Plasmid DNA
AE binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-1422s1c1
Sequence:CCGGGCTACCCAAAGATACTGCCTTCTCGAGAAGGCAGTATCTTTGGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-654s1c1
Sequence:CCGGCAGCATAAGCAGTACGCTAATCTCGAGATTAGCGTACTGCTTATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005605.1-1822s1c1
Sequence:CCGGCCCTAGTGATTACAGTAGTTTCTCGAGAAACTACTGTAATCACTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-1123s1c1
Sequence:CCGGCGGAGGAAACTAAAGAACAAACTCGAGTTTGTTCTTTAGTTTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-1119s1c1
Sequence:CCGGCAAGCGGAGGAAACTAAAGAACTCGAGTTCTTTAGTTTCCTCCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-1119s21c1
Sequence:CCGGCAAGCGGAGGAAACTAAAGAACTCGAGTTCTTTAGTTTCCTCCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-751s21c1
Sequence:CCGGAGCAAACACATTGCCTATAACCTCGAGGTTATAGGCAATGTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005605.1-1617s21c1
Sequence:CCGGTCCAGTATTTAGAGTACTATTCTCGAGAATAGTACTCTAAATACTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-654s21c1
Sequence:CCGGCAGCATAAGCAGTACGCTAATCTCGAGATTAGCGTACTGCTTATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-882s21c1
Sequence:CCGGGAAAGGTTGCAAGGTGTATAACTCGAGTTATACACCTTGCAACCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005605
VALIDATED
AEBP2 MISSION shRNA Lentiviral Transduction Particles
AE binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-1422s1c1
Sequence:CCGGGCTACCCAAAGATACTGCCTTCTCGAGAAGGCAGTATCTTTGGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-654s1c1
Sequence:CCGGCAGCATAAGCAGTACGCTAATCTCGAGATTAGCGTACTGCTTATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005605.1-1822s1c1
Sequence:CCGGCCCTAGTGATTACAGTAGTTTCTCGAGAAACTACTGTAATCACTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-1123s1c1
Sequence:CCGGCGGAGGAAACTAAAGAACAAACTCGAGTTTGTTCTTTAGTTTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005605.1-1119s1c1
Sequence:CCGGCAAGCGGAGGAAACTAAAGAACTCGAGTTCTTTAGTTTCCTCCGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-1119s21c1
Sequence:CCGGCAAGCGGAGGAAACTAAAGAACTCGAGTTCTTTAGTTTCCTCCGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-751s21c1
Sequence:CCGGAGCAAACACATTGCCTATAACCTCGAGGTTATAGGCAATGTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005605.1-1617s21c1
Sequence:CCGGTCCAGTATTTAGAGTACTATTCTCGAGAATAGTACTCTAAATACTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-654s21c1
Sequence:CCGGCAGCATAAGCAGTACGCTAATCTCGAGATTAGCGTACTGCTTATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005605.1-882s21c1
Sequence:CCGGGAAAGGTTGCAAGGTGTATAACTCGAGTTATACACCTTGCAACCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)