EMAIL THIS PAGE TO A FRIEND

AEN

apoptosis enhancing nuclease

78 Gene Product Result for
Synonyms: ISG20L1 pp12744
UniProtKB ID: Q8WTP8, C9J571, Q9BSA5, Q9H9X7
Gene ID:
Mouse(68048) apoptosis enhancing nuclease
Rat(361594) apoptosis enhancing nuclease
naked mole-rat(101726535) apoptosis enhancing nuclease
domestic guinea pig(100731952) apoptosis enhancing nuclease
sheep(101116260) apoptosis enhancing nuclease
chicken(415496) apoptosis enhancing nuclease
cow(614749) apoptosis enhancing nuclease
domestic cat(101092117) apoptosis enhancing nuclease
dog(488728) apoptosis enhancing nuclease
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022767 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022767 Rosetta Predictions human pricing
NM_001108487 Rosetta Predictions rat pricing
NM_026531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080505 predicted 477
2 SASI_Hs01_00080506 predicted 680
3 SASI_Hs02_00356049 predicted 500
4 SASI_Hs01_00080507 predicted 1557
5 SASI_Hs01_00080508 predicted 403
6 SASI_Hs01_00080509 predicted 1426
7 SASI_Hs01_00080510 predicted 1426
8 SASI_Hs01_00080511 predicted 1204
9 SASI_Hs01_00080512 predicted 718
10 SASI_Hs01_00080513 predicted 723
11 SASI_Hs01_00080514 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239129 predicted 1819
2 SASI_Rn02_00239130 predicted 659
3 SASI_Rn02_00239131 predicted 736
4 SASI_Rn02_00239132 predicted 1720
5 SASI_Rn02_00239133 predicted 1800
6 SASI_Rn02_00239134 predicted 1842
7 SASI_Rn02_00239135 predicted 1710
8 SASI_Rn02_00239136 predicted 747
9 SASI_Rn02_00239137 predicted 969
10 SASI_Rn02_00239138 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134030 predicted 548
2 SASI_Mm01_00134031 predicted 832
3 SASI_Mm01_00134032 predicted 521
4 SASI_Mm01_00134033 predicted 1103
5 SASI_Mm01_00134034 predicted 1614
6 SASI_Mm01_00134035 predicted 683
7 SASI_Mm01_00134036 predicted 1643
8 SASI_Mm01_00134037 predicted 832
9 SASI_Mm02_00330449 predicted 627
10 SASI_Mm01_00134039 predicted 1088
11 SASI_Mm01_00134038 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022767
VALIDATED
AEN MISSION shRNA Bacterial Glycerol Stock
apoptosis enhancing nuclease
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-902s21c1
Sequence:CCGGCACGGGCACTCATCAGTAGAACTCGAGTTCTACTGATGAGTGCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-744s21c1
Sequence:CCGGACTTCCAGGCGCTCAAGTATGCTCGAGCATACTTGAGCGCCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-679s21c1
Sequence:CCGGGGCCCAGAAAGAGATCCTTAACTCGAGTTAAGGATCTCTTTCTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-195s21c1
Sequence:CCGGCTTCCCTCACCATCCCAAATGCTCGAGCATTTGGGATGGTGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022767.3-1888s21c1
Sequence:CCGGGGACGAGAACTGGCATATTTACTCGAGTAAATATGCCAGTTCTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022767.2-620s1c1
Sequence:CCGGCCAGAAAGAGATCCTTAAGCTCTCGAGAGCTTAAGGATCTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_022767.2-623s1c1
Sequence:CCGGGAAAGAGATCCTTAAGCTCCTCTCGAGAGGAGCTTAAGGATCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022767.2-968s1c1
Sequence:CCGGCACAGACATGGAACAGTACATCTCGAGATGTACTGTTCCATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022767.2-521s1c1
Sequence:CCGGCAAGTACATCAGGCCTGAGATCTCGAGATCTCAGGCCTGATGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022767.2-147s1c1
Sequence:CCGGCCAAATGCCAAGGATGTGCTTCTCGAGAAGCACATCCTTGGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022767.2-143s1c1
Sequence:CCGGCATCCCAAATGCCAAGGATGTCTCGAGACATCCTTGGCATTTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022767.2-965s1c1
Sequence:CCGGCAGCACAGACATGGAACAGTACTCGAGTACTGTTCCATGTCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022767.2-974s1c1
Sequence:CCGGCATGGAACAGTACATGGAGGACTCGAGTCCTCCATGTACTGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022767
VALIDATED
AEN MISSION shRNA shRNA Plasmid DNA
apoptosis enhancing nuclease
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-902s21c1
Sequence:CCGGCACGGGCACTCATCAGTAGAACTCGAGTTCTACTGATGAGTGCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-744s21c1
Sequence:CCGGACTTCCAGGCGCTCAAGTATGCTCGAGCATACTTGAGCGCCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-679s21c1
Sequence:CCGGGGCCCAGAAAGAGATCCTTAACTCGAGTTAAGGATCTCTTTCTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-195s21c1
Sequence:CCGGCTTCCCTCACCATCCCAAATGCTCGAGCATTTGGGATGGTGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022767.3-1888s21c1
Sequence:CCGGGGACGAGAACTGGCATATTTACTCGAGTAAATATGCCAGTTCTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022767.2-620s1c1
Sequence:CCGGCCAGAAAGAGATCCTTAAGCTCTCGAGAGCTTAAGGATCTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_022767.2-623s1c1
Sequence:CCGGGAAAGAGATCCTTAAGCTCCTCTCGAGAGGAGCTTAAGGATCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022767.2-968s1c1
Sequence:CCGGCACAGACATGGAACAGTACATCTCGAGATGTACTGTTCCATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022767.2-521s1c1
Sequence:CCGGCAAGTACATCAGGCCTGAGATCTCGAGATCTCAGGCCTGATGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022767.2-147s1c1
Sequence:CCGGCCAAATGCCAAGGATGTGCTTCTCGAGAAGCACATCCTTGGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022767.2-143s1c1
Sequence:CCGGCATCCCAAATGCCAAGGATGTCTCGAGACATCCTTGGCATTTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022767.2-965s1c1
Sequence:CCGGCAGCACAGACATGGAACAGTACTCGAGTACTGTTCCATGTCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022767.2-974s1c1
Sequence:CCGGCATGGAACAGTACATGGAGGACTCGAGTCCTCCATGTACTGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022767
VALIDATED
AEN MISSION shRNA Lentiviral Transduction Particles
apoptosis enhancing nuclease
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-902s21c1
Sequence:CCGGCACGGGCACTCATCAGTAGAACTCGAGTTCTACTGATGAGTGCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-744s21c1
Sequence:CCGGACTTCCAGGCGCTCAAGTATGCTCGAGCATACTTGAGCGCCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-679s21c1
Sequence:CCGGGGCCCAGAAAGAGATCCTTAACTCGAGTTAAGGATCTCTTTCTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022767.3-195s21c1
Sequence:CCGGCTTCCCTCACCATCCCAAATGCTCGAGCATTTGGGATGGTGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022767.3-1888s21c1
Sequence:CCGGGGACGAGAACTGGCATATTTACTCGAGTAAATATGCCAGTTCTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022767.2-620s1c1
Sequence:CCGGCCAGAAAGAGATCCTTAAGCTCTCGAGAGCTTAAGGATCTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_022767.2-623s1c1
Sequence:CCGGGAAAGAGATCCTTAAGCTCCTCTCGAGAGGAGCTTAAGGATCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022767.2-968s1c1
Sequence:CCGGCACAGACATGGAACAGTACATCTCGAGATGTACTGTTCCATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022767.2-521s1c1
Sequence:CCGGCAAGTACATCAGGCCTGAGATCTCGAGATCTCAGGCCTGATGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022767.2-147s1c1
Sequence:CCGGCCAAATGCCAAGGATGTGCTTCTCGAGAAGCACATCCTTGGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022767.2-143s1c1
Sequence:CCGGCATCCCAAATGCCAAGGATGTCTCGAGACATCCTTGGCATTTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022767.2-965s1c1
Sequence:CCGGCAGCACAGACATGGAACAGTACTCGAGTACTGTTCCATGTCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022767.2-974s1c1
Sequence:CCGGCATGGAACAGTACATGGAGGACTCGAGTCCTCCATGTACTGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026531
AEN MISSION shRNA Bacterial Glycerol Stock
apoptosis enhancing nuclease
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026531.2-1361s1c1
Sequence:CCGGCCACAGCATGAGGAACTGTAACTCGAGTTACAGTTCCTCATGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-204s1c1
Sequence:CCGGCCTGAATACCAAGGATGTGGTCTCGAGACCACATCCTTGGTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-570s1c1
Sequence:CCGGCGTTCTCTATGACAAATACATCTCGAGATGTATTTGTCATAGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-582s1c1
Sequence:CCGGCAAATACATACGGCCTGAAATCTCGAGATTTCAGGCCGTATGTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-693s1c1
Sequence:CCGGCCTTAAGCTGTTGAAGGGCAACTCGAGTTGCCCTTCAACAGCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026531
AEN MISSION shRNA shRNA Plasmid DNA
apoptosis enhancing nuclease
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026531.2-1361s1c1
Sequence:CCGGCCACAGCATGAGGAACTGTAACTCGAGTTACAGTTCCTCATGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-204s1c1
Sequence:CCGGCCTGAATACCAAGGATGTGGTCTCGAGACCACATCCTTGGTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-570s1c1
Sequence:CCGGCGTTCTCTATGACAAATACATCTCGAGATGTATTTGTCATAGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-582s1c1
Sequence:CCGGCAAATACATACGGCCTGAAATCTCGAGATTTCAGGCCGTATGTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-693s1c1
Sequence:CCGGCCTTAAGCTGTTGAAGGGCAACTCGAGTTGCCCTTCAACAGCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026531
AEN MISSION shRNA Lentiviral Transduction Particles
apoptosis enhancing nuclease
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026531.2-1361s1c1
Sequence:CCGGCCACAGCATGAGGAACTGTAACTCGAGTTACAGTTCCTCATGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-204s1c1
Sequence:CCGGCCTGAATACCAAGGATGTGGTCTCGAGACCACATCCTTGGTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-570s1c1
Sequence:CCGGCGTTCTCTATGACAAATACATCTCGAGATGTATTTGTCATAGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-582s1c1
Sequence:CCGGCAAATACATACGGCCTGAAATCTCGAGATTTCAGGCCGTATGTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026531.2-693s1c1
Sequence:CCGGCCTTAAGCTGTTGAAGGGCAACTCGAGTTGCCCTTCAACAGCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks